Anacharis maxima Vogel, Forshage & Peters sp. nov.
Figs 2 G, 3 F, 13 A – E
Diagnosis
(n = 6, all males). Belongs to the eucharioides species group. Large species (3.5–4.0, mean 3.8 mm, unique in Northwestern European fauna). Similar to A. eucharioides by having the lateromedial area of the pronotum smooth to rugose (Fig. 13 B, smooth in A. minima, A. petiolata and A. typica, longitudinal carinae in A. martinae). Differing from all other Northwestern European species by its large size (other species usually not larger than 3.5 mm), its mesoscutellar sculpture having oblique to transversal carinae only in the anterior half between the mesoscutellar foveae (Fig. 13 D, smooth to entirely carinate or differently oriented carinae in other Northwestern European species) and having a LOL: metacoxa ratio of <0.225 combined with a head frontal height: mesoscutellum length ratio of ≤ 1.9 (Fig. 8 C right, LOL: metacoxa ratio usually> 0.225, if around 0.225, then head frontal height: mesoscutellum length ratio> 1.9 in other Northwestern European species). In the Western Palaearctic fauna, A. maxima is most similar to A. parapsidalis, mainly due to its size. Anacharis parapsidalis was not reported from Northwestern Europe but from Japan and Romania (Mata-Casanova et al. 2018). Anacharis maxima differs from A. parapsidalis in its mesoscutellar sculpture (Fig. 13 D, mesoscutellum reticulate-carinate all over mesoscutellum in A. parapsidalis), the lateromedial area of the pronotum is smooth to rugose (Fig. 13 B, reticulate-carinate in A. parapsidalis), the mesopleural line not reaching the posteroventral hypocoxal furrow (Fig. 13 B) (reaching it in A. parapsidalis) and the presence of punctures on the metasomal tergites (absent in A. parapsidalis).
Description.
Male. Size. Large; body: 3.5–4.0 (3.9) mm; antennae: 2.7–3.4 (3.1) mm; fore wing: 2.5–3.3 (3.3) mm
Colour. Body black (Fig. 13 A); scape, head, mesosoma, and metasoma entirely black (Fig. 13); pedicel largely black (Fig. 13 C), flagellomeres bicoloured dorsoventrally (Fig. 13 A); mid and hind coxa, as well as hind femur largely (Fig. 13 A), fore coxa partially black (Fig. 13 A, B) and hind tarsomeres darkened (Fig. 13 A), otherwise yellow (Fig. 13 A); mandibles basally and apically darkened, otherwise yellow (Fig. 13 C); palps pale yellow (Fig. 13 C).
Head. Trapezoid in frontal view, genae abruptly kinked, meeting mandibular base in an angle <90 ° (Fig. 13 C); lower face with thick silvery hairs (Fig. 13 C), punctate; clypeal margin usually slightly bilobed, clypeus with central convex area, medially to medioventrally smooth (Fig. 13 C), otherwise punctate-rugulose; malar area coriaceous, reaching from ventral eye margin along entire stretch of mandibular base (Fig. 18 B), anteroventral corner of mandibular base sometimes smooth; genae smooth around eye, with increasingly dense punctation and regular setae towards the hind margin (Fig. 13 B); upper face setose, punctured, with usually noticeable, sometimes shallow median dent; space between toruli smooth (Fig. 13 C); eyes with few scattered setae (Fig. 13 C); vertex setose; POL: OOL: LOL: OD 2.2: 1.3: 0.8: 1 (2.3: 1.3: 0.8: 1), glabrous along OOL and anterior to median ocellus; head in dorsal view 2.0 times wider than long, laterally longer than medially; vertex and occiput usually with shallow median furrow, occiput broadly yet finely striate to striolate (Fig. 13 D), not interrupted by median furrow.
Antennae. ♂ formula:
2.1-2.4 (2.2): 1: 2.6-2.7 (2.7): 2.3-2.4 (2.4): 2.2-2.3 (2.2): 2-2.1 (2.1): 2-2.1 (2): 1.9-2.1 (1.9): 1.9-2 (1.9): 1.8-2 (1.9): 1.8-1.9 (1.8): 1.7-1.9 (1.8): 1.7-1.8 (1.7): 2-2.6 (2.5)
Mesosoma. Mesosoma 1.3 times longer than high (Fig. 13 B); pronotal plate centrally smooth, laterally coriaceous with a few carinae radiating from the centre, setose centrally and laterally, otherwise glabrous; pronotum laterally with dense silvery setae (Fig. 13 B), with longitudinal carinae along anterior margin, reaching hind margin in ventral region, lateromedial area slightly rugose, without regular carinae (Fig. 13 B); mesopleuron sometimes coriaceous dorsally and ventrally of mesopleural line, otherwise smooth (Fig. 13 B), scrobiculate along anteroventral margin (Fig. 13 B), reaching into venter; mesopleuron setose along ventral margin, otherwise glabrous (Fig. 13 B); mesopleural line separated from posteroventral hypocoxal furrow (Fig. 13 B), ventral margin somewhat continuous, dorsally marked by few to some influent striae (Fig. 13 B); mesopleural triangle separated from mesopleuron by carina that fades before reaching the posterior subalar pit (Fig. 13 B), posterodorsally smooth and shiny (Fig. 13 B); axillulae well delimited (Fig. 13 E), inside setose and longitudinally striolate; mesoscutum 1.1 times wider than long and 1.3–1.4 (1.3) times longer than the mesoscutellum (Fig. 13 D); notauli deep and distinct, with strong transversal carinae inside (Fig. 13 D), without (Fig. 13 D) or with fine wrinkles along them; median lobe of mesoscutum setose (Fig. 13 D), sometimes somewhat coriaceous, then lateral lobes also coriaceous, but less than median lobe; mesoscutellar foveae usually well delimited posteriorly by circumfoveal carinae (Fig. 13 D), fusing with median carina or not (Fig. 13 D); median carina starting to branch obliquely to transversally before reaching posterior end of foveae (Fig. 13 D), circumscutellar carina raised posteriorly (Fig. 13 D, E), appearing like a posterodorsal tooth on the mesoscutellum in lateral view; posterior surface of mesoscutellum medially broadly raised, evenly setose, ventrally scrobiculate, surface reticulate-striate (Fig. 13 E); dorsal axillular area striate on posterolateral margin, otherwise smooth (Fig. 13 D, E); nuchal collar broadly projecting dorsally, point rounded (Figs 6 F, 13 E); fore trochanter, mid coxa and hind coxa with conspiciously long setae (Fig. 13 A).
Wings. Marginal cell of fore wing 2.6–2.9 (2.6) times longer than wide (Fig. 2 E); WIPs (Fig. 2 E): apical spot of hind wing narrow, covering less than half of the apical area.
Metasoma. 1.3 times longer than rest of body (Fig. 13 A); gaster twice as long as petiole (Fig. 13 A); petiole 1.3–1.5 (1.5) times longer than hind coxa (Fig. 13 A); metasomal tergite 2 (T 2) with two setae dorsolaterally on each side along weak band of punctures; T 3 and T 4 with narrow bands of punctures, T 5 and T 6 with broad bands of punctures; T 7 medially without punctures, otherwise filled with punctures with long setae dorsally.
Male genitalia. Parameral plate basally widened, ventrally with basal tooth-like projections pointing inwards (Fig. 3 E).
Female. Unknown.
CO 1 barcode.
n = 7. Maximum intraspecific distance: 0 %. Minimum distance to closest species ( A. eucharioides): 3.9 %. CO 1 barcode consensus sequence:
TATTTTATACTTTATTTTAGGTATTTGATCTGGAATAATAGGATCAAGATTAAGAATAATTATTCGAAT AGAATTAGGGACCCCATCCCAATTAATTATAAATGATCAAATTTATAATTCAATTGTAACTGCACATGCA TTTATTATAATTTTCTTTATAGTTATACCTATCATAGTAGGAGGATTTGGAAATTATTTAGTACCTTTAA TATTAATTTCTCCTGATATAGCTTTCCCTCGATTAAATAATTTAAGATTTTGATTTTTAATCCCTTCCTT ATTTTTAATAACAATTAATTTATTTATTGATCAAGGGACAGGAACAGGATGAACTGTTTATCCCCCATTA TCATCCATCACAGGTCATCCATCTATATCAGTAGATTTAGTTATTTACTCATTACATTTAAGTGGAATTT CTTCAATTCTTGGATCAATTAATTTTATTGTAACCATTTTAAATATACGAATAATCTCCATATCTATAGA CAAAGTCTCATTATTTATTTGATCTATTTTTTTAACTACAATTTTACTATTATTATCTTTACCCGTACTA GCAGGAGGATTAACTATACTATTATTTGATCGAAATTTAAATACATCTTTTTTTGACCCTACAGGAGGAG GAGACCCTATTCTTTATCAACACTTATTT
Type material.
Holotype. Germany • ♂; Bavaria, Rhön-Grabfeld, Hausen, Eisgraben, basalt depot at forest margin; 50.5026 ° N, 10.0895 ° E; ca 740 m a. s. l.; 12–23 Jul. 2018; Dieter Doczkal leg.; Malaise trap; ZFMK -TIS-2640744.
Paratypes. Germany • 5 ♂♂; Same collection data as for holotype; ZFMK -TIS-2640739, ZFMK -TIS-2640740 (ZSM), ZFMK -TIS-2640741 (SMNS), ZFMK -TIS-2640742 (NHMUK), ZFMK -TIS-2640743 (NHRS) . • 1 ♂; Rhineland-Palatinate, Vulkaneifel, Jünkerath, private garden, wet meadow, right next to ditch; 50.3343 ° N, 6.595 ° E; ca 450 m a. s. l.; 6–8 Aug. 2021; Jonathan Vogel leg.; Malaise trap; ZFMK -TIS-2640676 .
Other material examined.
Without DNA barcode. Sweden • 1 ♂; Uppland, Norrtälje, Singö; 15 Jul. 1962; Karl-Johan Hedqvist leg.; NHRS - HEVA 000023177 (NHRS) .
Switzerland • 1 ♂; Vaud, Aigle, Solalex; 4 Aug. 1954; Jacques Aubert leg.; specimen at MHNG .
Biology.
Summer species, flying from July to August, peak in July. No clear preferences in terms of habitat.
Distribution.
Germany (locus typicus: Bavaria, Rhön-Grabfeld, Hausen, Eisgraben), Sweden, Switzerland.
No DNA barcode matches with publicly available sequences from other countries.
Probably preferring higher altitudes, as all specimens were collected at 400 to 800 m a. s. l.
Etymology.
From the latin word “ maximus ”, meaning the greatest, referring to the tall size of the species.
Remarks.
A. maxima is not frequently collected, though with six specimens caught from one collection event at one site, it seems like it can be locally relatively abundant. The diagnosis against A. parapsidalis is based on comparisons with the SEM images and the redescription (Mata-Casanova et al. 2018) as no specimen of A. parapsidalis was available to us.
The morphometric analysis revealed only little overlap of A. maxima with the other species within the eucharioides species group (Fig. 8 C left). The lda extractor provided two ratios, which – separately – can almost and – in combination – fully separate A. maxima from the remaining species (Fig. 7, Fig. 8 C right). We included these ratios into the diagnosis of A. maxima . For this species, the morphometric analyses proved helpful in finding diagnostic characters. Note that this was not the case in A. eucharioides, and only partially in A. martinae (see above), highlighting both the morphometric variability and overall similarity of the Anacharis species and the power and applicability of multivariate morphometrics.