Anacharis minima Vogel, Forshage & Peters sp. nov.

Fig. 14 A – E

Diagnosis

(n = 1). Belongs to the eucharioides species group. Small species (2.4 mm). Similar to A. petiolata and A. typica by having a centrally smooth mesoscutellum (centrally carinate in A. eucharioides, A. martinae and A. maxima). The small body size and the narrow coriaceous texture of the malar space that extends only around the dorsal corner of the mandibular base (Fig. 19 A) is unique in the Palaearctic fauna (coriaceous texture of malar space extending along entire length of mandibular base in all other species).

Description.

Female. Size. Small; body: ♀ 2.4 mm. Antennae: ♀ 1.6 mm. Fore wing: 1.9 mm

Colour. Body black (Fig. 14 A); scape, head, mesosoma, coxa, petiole black (Fig. 14); mandibles (Fig. 14 C), palps (Fig. 14 B), rest of legs (hind tarsi darker) (Fig. 14 A) yellow; pedicel and flagellomeres (Fig. 14 A), tegulae (Fig. 14 B, D), and gaster (Fig. 14 A) dark brown.

Head. Roundish triangular in frontal view, genae not abruptly kinked (Fig. 14 C); lower face setose (Fig. 14 C), with punctures; clypeal margin margin bilobed and flanged, clypeus smooth; coriaceous texture of malar area narrow, coriaceous texture of the malar space narrow, extending only around the dorsal corner of the mandibular base (Fig. 19 A); genae smooth around eye, with increasingly dense punctation and regular setae towards the hind margin (Fig. 14 A); upper face sparsely setose and very few punctures, centrally with shallow dent (Fig. 14 C); space between toruli smooth; eyes with scattered setal stubs (Fig. 14 C); ocellar triangle with wide base, ocelli small, POL: OOL: LOL: OD = 3.1: 1.7: 1.4: 1.0; setose between lateral ocellus and eye, small glabrous area in front of median ocellus not reaching median dent of upper face; head in dorsal view 1.8 times wider than long, laterally longer than medially; vertex and occiput with smooth shallow median furrow, occiput with medially interrupted striolation (Fig. 14 D).

Antennae. ♀ formula:

1.9: 1.0: 2.1: 1.4: 1.4: 1.4: 1.4: 1.3: 1.2: 1.2: 1.2: 1.1: 2.1

Mesosoma. Mesosoma 1.3 times longer than high (Fig. 14 B); pronotal plate coriaceous, with some few radial carinae; pronotum laterally setose (Fig. 14 B), with only few carinae ventrally and along anterior margin (Fig. 14 B), posterodorsal area smooth and even (Fig. 14 B); mesopleuron without distinct coriaceous sculpture, scrobiculate along anterior margin (Fig. 14 B), setose along ventral margin, otherwise glabrous (Fig. 14 B); mesopleural line meeting posteroventral hypocoxal furrow with its ventral margin only, ventral margin somewhat continuous, dorsally marked by influent striae (Fig. 14 B); mesopleural triangle separated from mesopleuron by carina that fades before reaching the posterior subalar pit, setae mostly in anterior two-thirds; axillulae well delimited, inside setose and longitudinally rugose-carinate; mesoscutum 1.1 times wider than long and 1.4 times longer than the mesoscutellum (Fig. 14 D); notauli complete, inside not carinate, wrinkles weak to absent (Fig. 14 D); lateral and median lobes of mesoscutum centrally glabrous, otherwise setose, increasingly so towards margins (Fig. 14 D); mesoscutellar foveae closed, with circumfoveal carina delimiting each fovea (Fig. 14 D), not touching the median carina (Fig. 14 D); mesoscutellum smooth on dorsal and posterior surface (Fig. 14 D), posterior surface medially distinctly raised (Fig. 14 D), laterally smooth (Fig. 14 D); ventral half of dorsal axillular area rugose (Fig. 14 E); propodeal area defined by carinae (Fig. 14 E), inside carinate-rugose, median carina present ventrally (Fig. 14 E); nuchal collar broadly extending posteriorly, tip rounded (Figs 6 D, 14 E).

Wings. Marginal cell of fore wing 2.6 times longer than wide.

Metasoma. 1.2 times longer than rest of body (Fig. 14 A); gaster 2.3 times longer than petiole (Fig. 14 A); petiole 1.5 times longer than hind coxa Fig. 14 A); metasomal tergite 2 (T 2) and T 3 with weak line of punctures dorsally, T 4 with scattered band of punctures, T 5-6 with narrow band, T 7 with medially weaker band, laterally with few setae.

Male. Unknown

CO 1 barcode.

n = 1. Maximum intraspecific distance = not applicable. Minimum distance to closest species ( A. eucharioides) = 5.6 %. CO 1 barcode consensus sequence:

AATTTTATACTTTATTTTAGGTATTTGATCCGGAATAATAGGTTCAAGATTAAGAATAATTATTCGAAT AGAACTAGGAACCCCATCTCAATTAATCATAAATGATCAAATTTATAATTCAATTGTAACCGCACATGCC TTTATTATAATTTTTTTTATAGTTATACCCATTATAGTAGGAGGATTTGGAAATTATTTAGTGCCTTTAA TATTAATCTCTCCTGATATAGCTTTCCCACGATTAAATAATTTAAGATTTTGATTTTTAATCCCTTCCCT ATTTTTAATAACAATTAACTTATTTATTGATCAAGGAGCAGGGACAGGATGAACTGTATACCCACCATTA TCATCCCTCACAGGTCATCCATCTATATCAGTAGATTTAGTTATTTATTCACTACATTTAAGAGGTATCT CATCAATTCTTGGATCAATTAATTTTATTGTAACCATTTTAAATATACGAATAAACTCTGTATCTATAGA CAAAATTTCATTATTTATTTGATCTATCTTTTTAACTACAATTTTACTATTATTATCTTTACCTGTATTA GCAGGAGGATTAACTATATTATTATTTGATCGAAATTTAAATACATCTTTTTTTGACCCTACAGGAGGGG GAGACCCAATTCTTTATCAACACTTATTT

Type material.

Holotype. Germany • ♀; Baden-Württemberg, Karlsruhe, Malsch, Hansjakobstraße, garden; 48.8835 ° N, 8.3197 ° E; ca 120 m a. s. l.; 25 Oct. - 8 Nov. 2020; Dieter Doczkal leg.; Malaise trap; ZFMK -TIS-2640724.

Biology.

The holotype was collected in autumn (between October and November) in a garden.

Distribution.

Germany (locus typicus: Karlsruhe, Malsch).

No DNA barcode matches with publicly available sequences from other countries.

Holotype collected from ca. 120 m a. s. l.

Etymology.

From the latin word for “ the smallest ”, referring to its distinct small body size.

Remarks.

While A. minima is molecularly clearly distinct from other species, the morphology overlaps in many aspects with other species that show a smooth mesoscutellum. It is the name-giving small size that seems to hold the most diagnostic value but there is no way to say for sure which characters are morphologically diagnostic for A. minima based on a single specimen. Some specimens, which we currently classify as A. typica (NHRS - HEVA 000023181 and a specimen from MHNG) show similarities to the holotype of A. minima, but they deviate in size and sculpture to regard them as not conspecific. The morphological diagnosis is in need of extension by studying further material of which the barcode matches that of A. minima .