New taxa of butterflies supported by genomic analysis Author Zhang, Jing Author Cong, Qian Author Shen, Jinhui Author Song, Leina grishin@chop.swmed.edu Author Grishin, Nick V. text The Taxonomic Report of the International Lepidoptera Survey 2024 2024-11-04 12 3 1 63 journal article 2643-4806 Tribe Tagiadini Mabille, 1878 On the lectotype of Achlyodes cnidus Plötz, 1884 As we demonstrated recently (Zhang et al. 2024), Achlyodes cnidus Plötz, 1884 (type locality not specified) is a valid species of Gerosis Mabille, 1903 (type species Coladenia hamiltoni Nicéville, 1889 , which is a junior subjective synonym of Satarupa phisara (Moore, 1884)) with its nomenclature stabilized by the lectotype designation. Here, we illustrate the genitalia of the lectotype ( Fig. 22 ) and, before dissection, extracted DNA from its abdomen (NVG-23075D07, sequence dataset combined with NVG-21115E07 from a leg) to improve the genomic dataset that is now used in the three phylogenetic GenBank PQ489705, 658 base pairs is: Fig. 22. Genitalia of Gerosis cnidus ( Plötz, 1884 ) lectotype ♂ in different views: a) left lateral, b) right lateral, c) posterior, d) dorsal, e) ventral, f) right posterolateral. Note slightly asymmetrical valvae, strongly asymmetrical aedeagus bent in the lateral direction, and expanded juxta shaped like a broad leaf of an Agave plant. Fig. 23. Phylogenetic trees of selected Gerosis species inferred from protein-coding regions in a) the nuclear genome (autosomes), based on 7,793,238 positions, b) the Z chromosome, based on 217,887 positions, and c) the mitochondrial genome. Ultrafast bootstrap (Minh et al. 2013) values are shown at nodes, and three species are colored: G. phisara (blue), G. cnidus (magenta), and G. tristis (Eliot, 1959) (green). AACTCTATATTTTATTTTTGGAATTTGAGCAGGAATAGTGGGAACTTCTCTTAGTTTATTAATTCGAACTGAATTAGGAAACCCTGGATCTTTAATTGGAGATGATCAAATTTATAATACT ATCGTAACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGAAATTGACTTGTTCCATTAATATTAGGAGCACCTGATATAGCCTTCCCACGAA TAAATAACATAAGATTTTGATTATTACCTCCATCTCTTACTCTTTTAATTTCTAGAAGTATCGTAGAAAACGGTTCAGGAACTGGTTGAACTGTTTACCCCCCTTTATCTTCTAATATTGC TCATCAAGGAGCTTCTGTTGACTTAGCTATTTTTTCATTACATTTAGCTGGTATTTCTTCTATTTTAGGAGCAATTAATTTTATTACTACTATTATTAACATACGAATTAAAAATTTATCT TTTGACCAAATACCTTTATTTGTTTGAGCTGTAGGAATTACAGCATTATTACTTCTTCTTTCACTTCCAGTTTTAGCAGGTGCTATTACAATATTATTAACAGATCGTAATCTTAATACAT CATTTTTTGATCCTGCAGGAGGAGGAGATCCAATTTTATATCAACATTTATTT