Taxonomic advances driven by the genomic analysis of butterflies Author Zhang, Jing Author Cong, Qian Author Shen, Jinhui Author Song, Leina grishin@chop.swmed.edu Author Grishin, Nick V. text The Taxonomic Report of the International Lepidoptera Survey 2024 2024-02-03 11 7 1 43 journal article 2643-4806 2B44E674-0784-4977-ADE5-A8AD69E30582 Metrocles nun Grishin , new species http://zoobank.org/ 40F78E1E-A010-4A7C-83CD-A1B5C9DFBBE1 ( Figs. 28 part, 29, 30a) Definition and diagnosis. Genomic analysis of an unusually patterned specimen from Goiás Brazil ( Fig. 29 ) somewhat resembling Metrocles schrottkyi (Giacomelli, 1911) ( type locality in Argentina ) ( Fig. 30b ) in its wing pattern and a tri-partite brand that is nearly shaped into a stigma, places it in Metrocles Godman, 1900 ( type species Metrocles leucogaster Godman, 1900 ) sister to Metrocles argentea (Weeks, 1901) ( type locality in Bolivia ) ( Fig. 28 ). This specimen represents a new species that differs from all similar species by a combination of a nearly straight white discal band on reddish-brown ventral hindwing with its white inner margin that continues along the sides of the thorax, behind the eyes and onto the collar, thus forming a continuous hairpin-shaped white framing from tornus of one hindwing to the other, and the lack of white spots in the forewing discal cell. Metrocles schrottkyi lacks this white hairpin framing. In DNA, a combination of the following characters is diagnostic in the nuclear genome: aly 2850.3.4 :C63T, aly103.44.1:C60T, aly 1591.7.3 :T331C, aly127.37.1:G699A, aly127.37.1:C721A, aly2850. 3.4:C75C (not T), aly6398.4.4:G66G (not A), aly6398.4.4:C72C (not G), aly499.16.2:C159C (not T), aly3268. 8.1:C138C (not T) and in COI barcode: T49C, T197C, T235C, T529A, T595C. Barcode sequence of the holotype . Sample NVG-18117A01, GenBank PP254259, 658 base pairs: AACTTTATATTTTATTTTTGGAATTTGAGCAGGAATAGTAGGAACTTCCCTAAGATTATTAATTCGAACTGAATTAGGAGCTCCTGGATCATTAATTGGAGATGATCAAATTTATAATACT ATTGTTACAGCTCATGCATTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGAAATTGACTAGTTCCTTTAATATTAGGAGCTCCTGATATAGCATTCCCTCGAA TAAATAATATAAGATTTTGAATATTACCCCCATCATTAACTTTATTAATTTCTAGAAGAATTGTAGAAAATGGTGCAGGTACTGGTTGAACAGTTTATCCTCCTTTATCTTCTAATATTGC CCATCAAGGATCTTCTGTTGATTTAGCAATTTTTTCACTTCATTTAGCTGGTATCTCATCAATCTTAGGAGCTATTAACTTTATCACAACAATTATTAATATACGAATTAGAAATATATCA TTTGATCAAATACCTTTATTTGTATGATCTGTAGGAATTACAGCATTATTATTACTTTTATCTTTACCTGTTCTAGCTGGAGCTATTACTATATTACTTACTGATCGAAACTTAAATACTT CATTTTTTGATCCTGCTGGAGGAGGTGATCCTATTTTATATCAACATTTATTT Type material. Holotype : ♂ currently deposited in the National Museum of Natural History, Smithsonian Institution, Washington , DC , USA [ USNM ], illustrated in Fig. 29 , bears seven printed labels (text in italics handwritten): six white [24 kil. E. Formoso, | Go., Brazil | May 16, 1956 | F. S. Truxal], [MACHRIS BRAZILIAN | EXPEDITION – 1956 | LOS ANGELES | COUNTY MUSEUM ], [genitalia | slide/vial # | H 78 | Prep. S.S. Nicolay], [ Chalcone | zisa ♂ | Det. Plotz | S.S. Nicolay], [DNA sample ID: | NVG-18117A01 | c/o Nick V . Grishin ], [USNMENT | {QR Code} | 01531662], and one red [ HOLOTYPE ♂ | Metrocles | nun Grishin ]. Fig. 28. Phylogenetic trees of selected Metrocles species inferred from protein-coding regions of a) the nuclear (autosomes) and b) the mitochondrial genome. Different species are colored differently: M. santarus (E. Bell, 1940) (cyan), M. scitula (Hayward, 1951) (blue), M. nun sp. n. (magenta), M. argentea (green), and M. zisa (Plötz, 1882) (black). Fig. 29. Holotype of Metrocles nun sp. n. in dorsal (left) and ventral (right) views, data in text. Fig. 30. Two species of Metrocles , iNaturalist observations from Brazil: a) Metrocles nun sp. n. (possible, or a close relative) 111942398 Brasília, Distrito Federal, 18-Apr-2022 © Antônio (ajcaguiar); b) Metrocles schrottkyi 155279605 São Paulo, Santo André, Paranapiacaba, 28-Jan-2023 © rick_costa. Images are color-corrected, rotated, cropped, and b) flipped. CC BYNC 4.0 https://creativecommons.org/licenses/by-nc/4.0/. Type locality. Brazil : Goiás , 24 km east of Formoso . Etymology. A resting individual of this species, with its dark color and white framing from collar to tornus, resembles a nun ( Fig. 30a ), hence the name, which is a noun in apposition. Distribution. Currently known from Central Brazil . Comments. Although we have not yet sequenced M. schrottkyi ( Fig. 30b ), querying the BOLD database ( Ratnasingham and Hebert 2007 ) with COI barcodes of our sequenced specimens reveals that it is a species different from either Metrocles scitula (Hayward, 1951) ( type locality in Brazil : Mato Grosso ) and this new species, although closely related to them (~2.5% difference).