Urbanus (Urbanus) oplerorum Grishin, 2023

Zhang, Jing, Cong, Qian & Grishin, Nick V., 2023, Thirteen new species of butterflies (Lepidoptera: Hesperiidae) from Texas, Insecta Mundi 2023 (969), pp. 1-58 : 11-13

Urbanus (Urbanus) oplerorum Grishin , new species

https://zoobank.org/ D236B083-93CB-4975-ACA5-F42BF02C1C62

( Fig. 5 part, 8)

Definition and diagnosis. Previously identified and reported as Urbanus viterboana (Ehrmann, 1907) (type locality in Colombia) ( Bordelon 2011) and keys to it in Steinhauser (1981), and to C.13.2(b) in Evans (1952). However, genomic sequencing of the holotype of U. viterboana and phylogenetic analysis reveals that it ( Fig. 5 red) is not conspecific with U. viterboana ( Fig. 5 green) and instead is sister to Urbanus bernikerni Burns, 2014 (type locality in Costa Rica) ( Fig. 5 cyan). Differs from U. bernikerni by 3.3% (22 bp) in the COI barcode, and from Urbanus viterboana (Ehrmann, 1907) by 5% (33 bp), forms a separate distinct clade in genomic trees and therefore is a species-level taxon. In facies ( Fig. 8 ), differs from U. viterboana in having larger, rectangular, and hourglass-shaped (rather than rounder and some being nearly triangular) hyaline forewing spots; from U. bernikerni by more brilliant-blue (rather than greenish) dorsal overscaling and yellower hyaline spots; and from Urbanus segnestami Burns, 2014 (type locality in Costa Rica) by less extensive, and bluer, overscaling that does not extend past the basal half of hindwing. Due to individual variation and similarity between these semi-cryptic species, confident identification is achieved by genotype. In DNA, a combination of the following base pairs is diagnostic in nuclear genome: aly216.58.7:G39A, aly669.9.1:A231G, aly770.19.8:G63A, aly 1405.5.10:G81A, and aly216.58.7:G42T, and COI barcode: T64C, A202T(not C), T277T(not A), T283C, T287C, T409T(not C), and T514A(not C).

Barcode sequence of the holotype. Sample NVG-14112E06, GenBank OP762100, 658 base pairs:

AACCTTATATTTTATTTTTGGAATTTGAGCAGGATTAATTGGAACTTCTTTAAGATTACTTATCCGAACAGAATTAGGAACCCCAGGA TCTTTAATTGGAGATGACCAAATTTATAATACTATTGTAACAGCTCATGCATTTATTATAATTTTTTTTATAGTTATACCTATTATAATTG GAGGATTTGGTAATTGATTAGTTCCTTTAATAATAGGTGCTCCTGATATAGCTTTCCCCCGTATAAATAATATAAGATTTTGATTATTAC CCCCCTCTTTAACCTTACTAATTTCAAGAAGAATTGTTGAAAATGGTGCTGGTACTGGATGAACAGTTTACCCCCCTCTTTCATCTAA TATTGCCCATCAAGGAGCCTCAGTTGATCTAGCAATTTTTTCCCTTCATCTTGCTGGAATTTCATCTATTCTTGGAGCTATTAATTTTA TTACAACAATTATTAATATACGAATTAATAAATTAACTTTTGATCAAATACCTTTATTTGTATGAGCAGTAGGAATTACAGCATTATTATT ATTACTTTCTTTACCTGTTTTAGCTGGAGCTATTACCATATTATTAACTGATCGAAATTTAAATACATCATTTTTTGATCCTGCTGGAGG AGGAGATCCAATTTTATATCAACATTTATTT

Type material. Holotype: ♀ deposited in the National Museum of Natural History , Smithsonian Institution, Washington, DC, USA ( USNM), illustrated in Fig. 8a , bears the following three rectangular labels, two white: [ TX: Hidalgo Co., | Mission/Madero | 4-VI-10 | Mike Rickard], [DNA sample ID: | NVG-14112E06 | c/o Nick V. Grishin], and one red [HOLOTYPE ♀ | Urbanus | oplerorum Grishin ] . Paratype: 1♀ Mexico: Tamaulipas, Gomez Farias,leg. Paul A.Opler and Evi M. Buckner-Opler 13-14-Oct-2003, NVG-17067E10, CSU _ENT1038946, in CSUC.

Type locality. USA: Texas, Hidalgo Co., Mission/Madero.

Etymology. The name honors Paul A. Opler and Evi M. Buckner-Opler who collected the paratype on one of their many expeditions that contributed most significantly to our knowledge of Lepidoptera . Paul’s lifelong contributions to Lepidopterology cannot be overstated, being immensely broad and far-reaching: in science, education, conservation, and dissemination of knowledge through best-selling books. During the last several years, Paul and Evi have been collecting and preserving butterflies for genomic analysis, and their excellent material forms the foundation for the genomic studies of western USA species. The name is a noun in the genitive case.

English name. The Oplers’ longtail.

Distribution. Presently known from South Texas and Mexico: Tamaulipas.

Figures

Figure 5. Trees of selected Urbanus (Urbanus) species constructed from protein-coding regions in a) nuclear and b) mitochondrial genomes:U. rickardi sp. n. (orange), U. pronus (blue), U. alva (purple), U. viterboana (green), U. oplerorum sp. n. (red), and U. bernikerni (cyan) among their relatives (black). Primary type specimens are labeled in magenta. See Fig. 1 legend for other notations.

Figure 8. The type series of Urbanus (Urbanus) oplerorum sp. n. a) holotype ♀ NVG-14112E06, b) paratype ♀ NVG-17067E10, dorsal (left) and ventral (right) views, data in text.