Telegonus tsongae Grishin, 2023

Zhang, Jing, Cong, Qian & Grishin, Nick V., 2023, Thirteen new species of butterflies (Lepidoptera: Hesperiidae) from Texas, Insecta Mundi 2023 (969), pp. 1-58 : 17-22

Telegonus tsongae Grishin , new species

https://zoobank.org/ 926DF925-40ED-45AF-A379-451262C255D6

( Fig. 10 part, 11–20)

Definition and diagnosis. Genomic comparison of Telegonus fulgerator group species reveals that specimens from the US, together with Mexican specimens, form a distinct clade that cannot be associated with any available name and therefore represents a new taxon ( Fig. 10 red). It is closest to T. misitra ( Plötz, 1881) (type locality in Mexico) ( Fig. 10 blue) and the two taxa are sisters in the mitochondrial genome tree, but their COI barcodes differ by 2.6% (17 bp) and Fst / Gmin statistics for them are 0.53/0.003 suggesting strong genetic differentiation. The caterpillar patterns ( Fig. 16–20 ) and foodplants ( Fig. 14 ), both used as characters to differentiate a complex of sympatric species ( Hebert et al. 2004),differ as well. Therefore, the red clade is a new species. Distinguished from its relatives by a combination of blue (not greenish) wing bases and body above, usually 4 nearly equal in size forewing hyaline spots in a row,straight discal band of hyaline spots, narrower than in many other species, spot at the base of cell M 3 -CuA 1 typically small, within the band, spot in cell CuA 1 -1A+2A also small or missing, aligned with the band or a little offset distad; the body beneath is pale-yellow (specimens reared in the lab) to orangeyellow (most adults collected in the field), the white segment at the base of hindwing near costa barely reaches the middle of costal margin from the base. Caterpillar with pattern distinct from other Telegonus species ( Hebert et al. 2004): each segment is dorsally black with a yellow crossband in distal half, the band narrowing laterally and in the middle, where it may be separated into two spots; there are two white streaks behind each segment of the band, lower half of the body and the head reddish. The yellow bands are deeper in color, different from paleyellow bands in T. misitra , and are broader than narrow and typically uniform in width bands of T. misitra . The caterpillar feeds on the leaves of Karwinskia Zucc. (Rhamnaceae) , also recorded as a rarely used (in addition to mostly various Fabaceae Lindl. ) foodplant of T. misitra (i.e., SENNOV) ( Hebert et al. 2004). Due to known and potentially undiscovered variation in the phenotypic characters, including caterpillar patterns, the new species can be reliably diagnosed by DNA,and a combination of the following base pairs is diagnostic in nuclear genome: aly173.14.1:C1732T, aly1080.27.6:C1648G, aly173.14.1:T1902C, aly383.21.1:C4023T, and aly1080.27.6:A1301T, and COI barcode: A229G, T283C, T292C, T578C, and T596C.

Barcode sequence of the holotype. Sample NVG-3614, GenBank OP762105, 658 base pairs: AACCTTATATTTTATTTTTGGAATTTGAGCAGGACTAATTGGAACTTCCTTAAGATTACTTATTCGAACTGAATTAGGAACCCCAGGAT CTTTAATTGGAGATGATCAAATTTATAATACAATTGTTACAGCTCATGCATTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGG AGGATTTGGAAATTGACTAGTTCCATTAATAATAGGTGCCCCAGATATGGCTTTCCCCCGTATAAATAACATAAGATTTTGATTATTGC CCCCATCTTTAACCTTATTAATCTCAAGAAGAATTGTTGAAAATGGAGCTGGTACAGGATGAACAGTTTATCCCCCTCTTTCATCAAA TATTGCCCATCAAGGAGCATCTGTTGATTTAGCAATTTTTTCCCTTCATCTTGCTGGTATTTCATCAATTCTTGGAGCTATTAATTTTA TTACAACAATTATTAATATACGAATTAATAATTTATCTTTTGATCAAATACCTTTATTTGTTTGAGCTGTAGGAATTACAGCATTATTATT ATTACTTTCATTACCTGTTTTAGCAGGTGCTATTACTATACTATTAACAGATCGAAATCTAAATACTTCTTTTTTTGATCCTGCAGGAGG AGGAGATCCAATCTTATACCAACACTTATTT

Type material. Holotype: ♂ deposited in the National Museum of Natural History , Smithsonian Institution, Washington, DC, USA ( USNM), illustrated in Fig. 11 , bears the following three rectangular labels, two white: [ USA: TEXAS: Starr Co., | Roma, near International | Bridge, 26.40472, −99.01859 | 14-Jun-2015, leg. Qian Cong], [DNA sample ID: | NVG-3614 | c/o Nick V. Grishin], and one red [HOLOTYPE ♂ | Telegonus | tsongae Grishin ] . Paratypes: 30♂♂ and 21♀ USA: Texas: 1♂ 11-BOA-15610C09 Val Verde Co., Devil’s River State Natural Area, 3rd side canyon off Dolan Creek , GPS 29.9120, −100.9841, 17-Apr-2004, Tony Gallucci leg. [ TMMC] ; 1♂ 11-BOA-15610C10 Travis Co., Austin, Upper Stillhouse Hollow ( Wild Park ), 2-May-1985, C. J. Durden leg. [ TMMC] ; 2♂♂ NVG-3422 ( Fig. 13 ), NVG-3427, 1♀ NVG-3426 (latter 2 in copula) Cameron Co., 2.5 mi SW of Sebastian , 30-May-2015, N. V. Grishin leg. ; Starr Co., Roma , by the international bridge, GPS around 26.4048, −99.0185, 31-May-2015: Denise Tan leg. 1♂ NVG-3456 ; N. V. Grishin leg.: 6♂♂ NVG-3453,-3455, -3457, -3458, -3459, -3460 ( Fig. 12e–m ) ; 1♂ NVG-3613 14-Jun-2015; ex larvae, eclosed in 2015: 4♂♂ NVG-4191 18-Jul, NVG-4374 2-Aug, NVG-4372 3-Aug, NVG-4568 24-Aug and 6♀♀ NVG-4206 18- Jul, NVG-4373 2- Aug, NVG-4391 6- Aug , NVG-4392 7- Aug , NVG-4471 13- Aug , NVG-4518 16- Aug ; Roma , GPS 26.4148, −99.0224, 28- Jun-2015, N. V. Grishin leg.: 2♂♂ NVG-3831, -3834 and 1♀ NVG-3833 ; Roma Creek , GPS 26.4222, −99.0307, ex larvae, N. V. Grishin leg., eclosed: 1♂ NVG-511 3-Jan-2008, 1♂ 6-Jan-2008 ; 1♀ 20-Jan-2008 ; Falcon Heights, ex ♀ M. Reid leg., ex ova, eclosed: 8♂♂: 8-, NVG-514 11-, 15-, 16-, 17-, 17-, 21-, 23-Jan-2008 and 11♀♀: NVG-512 9-, NVG-513 11-, 13-, 15-, 16-, 18-, 20-, NVG-517 21-, 24-, 26-, 27-Jan-2008; Mexico: Nuevo Leon: 1♂ 11-BOA- 15610D01 Santiago, Cola de Caballo , GPS 25.36854, −100.1571, 19-Aug-1977, C. J. Durden leg. [ TMMC] ; 1♂ NVG-17113A11 60 mi SE Monterrey, Cumbres de Monterrey National Park , 13-Oct-1980, J. Robb leg. [ TMMC] ; 1♀ NVG-15610C12 San Luis Potosi, Maiz, El Salto , 28-Jul-1981, C. J. Durden leg. [ TMMC] .

Type locality. USA: Texas, Starr Co., Roma, by the international bridge, GPS 26.4047, −99.0186.

Etymology. The name honors the collector of the holotype, Qian Cong (pronounced as Tsien Tsong, hence the spelling of the species name), who pioneered genomic sequencing in our lab and developed unique protocols to obtain whole genome shotgun datasets of historical specimens in collections regardless of their age. Without her contributions, this and all other genomics studies by our group would have been simply impossible. The name is a noun in the genitive case.

English name. Qian’s flasher, pronounced as Tsien’s flasher.

Distribution. Southern Texas and Mexico, currently confirmed in the states of Nuevo Leon and San Luis Potosí.

Caterpillar foodplant and habitat. In Texas, we are aware of a single caterpillar foodplant, which is Coyotillo: Karwinskia humboldtiana (Schult.) Zucc. (Rhamnaceae) ( Fig. 14a,b, d ). Plants growing in the open are not widely utilized ( Fig. 14a ) and plants in the shaded areas, frequently on the slopes and near water ( Fig. 14c ), are selected for oviposition.

Life history and rearing. Eggs are glued singly or in small numbers to the underside of fully opened leaves of K. humboldtiana growing in the shade ( Fig. 16b, d ), both on small plants near the ground, or on older plants above 2 meters. Caterpillars go through five instars and live in shelters they build from leaves ( Fig. 16 , 19j ), in which they pupate. We have found all caterpillar instars and pupal exuviae in nature, but to document the life history, we reared this species from oviposition by females in captivity.

Coyotillo branches with cut ends wrapped into moist paper towel and covered with foil to prevent evaporation were secured with scotch tape near the bottom of a plastic transparent container in a manner to create enough space for the female to move around but block it from freely reaching the bottom. When this container is turned over ( Fig. 15a ), the female typically ends up sitting on the leaves after each brief flight. Placed under a lamp to emulate bright day conditions and provide heat, the female failed to oviposit after several days. However, many eggs were obtained ( Fig. 15b ) when the container with the female was moved for an hour (checked every 15 min to prevent overheating) into a car parked outside, partly in the shade provided by trees. The temperature inside the car nevertheless reached 110°F and possibly beyond. This procedure was repeated daily for a week, and the female fed every other day with a diluted sugar (sucrose) solution absorbed by a piece of paper towel ( Fig. 15c ). The proboscis needed to be uncoiled by an insect pin (female held by wings) and dipped into the moist towel to initiate feeding. After this forced initiation, a grip on the female wings was released and she continued to feed for several minutes.

Eggs are white, dome-shaped, nearly spherical ( Fig. 17a–d ), develop 5-7 days, and turn orange-brown (caterpillar head and body showing through the transparent shell) before hatching ( Fig. 17e ). The hatched caterpillar is yellow with brown-orange head and black collar ( Fig. 17g, h ); it crawls to a leaf edge and starts feeding. Caterpillar becomes greenish-yellow upon feeding ( Fig. 17i, j ) and starts building a shelter ( Fig. 17k ). Two narrow cuts are chewed out from the leaf with a leaf segment between them several times wider than a caterpillar. Then, a silk pad is made at the base of this segment between the two cuts ( Fig. 16h ). As silk threads contract with time, they folds the leaf segment (with the caterpillar on it) over and place it on top of the rest of the leaf ( Fig. 16e, f, i ). When the tip of the segment comes close to the leaf surface, the caterpillar secures it to the leaf with silk ( Fig. 16j , arrow 2). All shelters we observed were folded over the upper surface of the leaf, with lower surface of the leaf segment exposed.

The second-instar caterpillar is darker, olive-green, with yellow-green dots in rows ( Fig. 17q–z ). By the next molt, a central yellow crossband on each segment develops in addition to the dots, and this band is clearly defined in the third instar ( Fig. 18a–d ). Besides the yellow band, the growing third instar gains a narrow white crossband on each segment and loses yellow-green dots. The ventral side and the distal part of the last abdominal segment become red. The fourth instar is black above, red beneath, and each segment with yellow and white bands, mostly narrower or broken in the middle ( Fig. 18e–h ). Head brown-red, covered with setae. The fifth and final instar is similar, but setae on the head more extensive and longer, and the head is larger comparatively to the body, which is covered in sparse white very fine setae (Fig. 119a–i). Head darker in the middle and with 3 paler longitudinal stripes on each side ( Fig. 20a ).

Out of several dozen caterpillars, both wild-collected and reared from eggs, only this color morph was observed, without variation, although the width of yellow bands in the last two instars varied somewhat ( Fig. 18e–h , 19a–i ). Male caterpillars can be distinguished from females by testes seen through the skin of the 8 th segment ( Fig. 20b ). The testes appear as a doublet of orange-red oval bodies in the middle of the segment. In females, the middle area of the 8 th segment around the yellow band is black ( Fig. 20c ).

The prepupal caterpillar builds a roomy shelter for pupation, with extra space needed for the wing cases to expand significantly in the pupa for it to form properly. A Y-shaped girdle supports the prepupa resting on it and hooked by the last pair of legs to the silk pad ( Fig. 19j ). It appears that the lack of contact with the leaf in a prepupa suspended this way is important for pupation and proper expansion of wing cases, because damage to the girdle sometimes resulted in asymmetrical pupae with reduced wing cases.

The freshly formed pupa turns brown with orange dorsal stripes ( Fig. 19k ) that partly fade within a day and the pupa develops white bloom covering its entire surface except around the spiracles and some joints ( Fig. 19l ). This bloom is a very fine powder that can be rubbed off the pupa upon the slightest touch. Removal of the bloom, typical of many Eudaminae pupae, did not affect pupal development in captivity. Pupae eclosed in 15–17 days.

Figures

Figure 10. Trees of Telegonus fulgerator complex constructed from protein-coding regions in a) Z chromosome and b) mitochondrial genome: T. tsongae sp. n. (red), T.misitra (blue), T. catemacoensis (cyan), T. azul (green), T. fulgerator (purple), and T. fulminator (orange) among their relatives (black). Primary type specimens are labeled in magenta and paralectotype of T.misitra in olive. See Fig. 1 legend for other notations.

Figure 11. Holotype of Telegonus tsongae sp. n. dorsal (left) and ventral (right) views, data in text.

Figure 12. Telegonus tsongaesp. n. in nature,USA:Texas.a–d) iNaturalist observations.a–b) Hidalgo Co.,Bentsen- Rio Grande Valley State Park: 108107791♂ 27-Oct-2008 © John Rosford and 110234060♀ 25-Dec-2014 © Mark + Holly Salvato, respectively; c) 2090814 ♀ Uvalde Co.,Cooks Slough Nature Park, 12-Sep-2015 © Diana-Terry Hibbitts; d) 787547♀ Williamson Co., Liberty Hill, 16-Jul-2014 © Goolsbygirl. Some images were color-corrected and are available under CC BY-NC 4.0 https://creativecommons.org/licenses/by-nc/4.0/; e–m) paratype ♂ NVG-3460 at the type locality, perching in various poses under varying (natural) lighting, 31-May-2015 © Nick V. Grishin, m) overall view of the perch with the paratype in the middle of the image, pose magnified in l).

Figure 13. Genitalia of Telegonus tsongae sp. n. paratype NVG-3422 (data in text) in different views. a) left lateral, b) left posterolateral, c) dorsal, d) ventral.

Figure 14. Caterpillar foodplant and habitat of Telegonus tsongae sp. n., USA: Texas, Starr Co., Roma Creek, 3- Nov-2007. a, b, d) Karwinskia humboldtiana, a) growing in the open, not readily used for oviposition, b) flowers, c) shaded section of an arroyo (destroyed by now), a typical habitat of immature stages, d) enlarged leaves.

Figure 15. Inducing oviposition in a captive female of Telegonus tsongae sp. n., USA: Texas, Starr Co. a) a plastic container with a female on the caterpillar foodplant Karwinskia humboldtiana, 27-Oct-2007, b) many eggs obtained and c) the female feeding on sugar solution, 4-Nov-2007.

Figure 16. Shelters of early instar caterpillars of Telegonus tsongae sp. n., USA: Texas, Starr Co., Roma Creek, 3-Nov-2007 (except i–j. on 7-Nov). a–e) leaves with feeding damage and abandoned shelters, b, d) an eggshell beneath the leaves, indicated by a yellow arrow and enlarged in b’) and d’); e) two shelters on one leaf; f–j) shelters with caterpillars, closed (natural appearance, f, i) and teared-open (for photography, g, h, j); arrows indicate silkpads to fold the shelter (at the base, 1) and to secure it to the leaf (at the tip, 2).

Figure 17. Eggs and earlier instar caterpillars of Telegonus tsongae sp. n., USA: Texas, Starr Co., 2007. a–e) eggs, f) eggshell, g–p) 1st instar, q–z) 2rd instar. d, f, k, m) 3-Nov, a, b, c, l, n, o) 4-Nov, p) 5-Nov, r–s) 6-Nov, e, q, t, v) 7-Nov, g, h, i, j, w, x) 8-Nov, u, y, z) 20-Nov.

Figure 18. Late instar caterpillars of Telegonus tsongae sp. n., USA: Texas, Starr Co., 2007. a–d) 3rd instar, e–h) 4th instar. a) 16-Nov, b, c, d) 18-Nov, e) 19-Nov, h) 20-Nov, f) 23-Nov, g) 28-Nov, i) 3-Dec.

Figure 19. Ultimate instar caterpillars and pupa of Telegonus tsongae sp. n., USA: Texas, Starr Co., 2007. a–i) 5th instar caterpillar, j) prepupa, k) pupa within an hour of molting of the caterpillar shown in j), l) the same pupa with developed white bloom several hours after molting; a–c) 28-Nov, the same individual, d) 3-Dec, e, i. 9-Dec, the same individual, f) 16-Dec, j) 17-Dec, k) 18-Dec, g, l) 19 Dec; h) 30-Dec.

Figure 20. Ultimate (5th) instar caterpillar of Telegonus tsongae sp. n., USA: Texas, Starr Co., 2007. a) head in anterodorsal view, b) ♂ c) ♀ 8th segment in dorsal view, a pair of orange testes seen through in ♂, d) last segments in dorsal view; a, d) 25-Dec, the same individual; b–c) 30-Dec.