Synargis tenebritorna, Zhang & Cong & Shen & Song & Grishin, 2024

Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina & Grishin, Nick V., 2024, Taxonomic advances driven by the genomic analysis of butterflies, The Taxonomic Report of the International Lepidoptera Survey 11 (7), pp. 1-43 : 22-23

Synargis tenebritorna Grishin, new species

http://zoobank.org/ A7E8E1AF-38EC-4843-8120-1F42E07E6601 ( Figs. 15 part, 17b)

Definition and diagnosis. Genomic analysis of the S. regulus group reveals a clade that, being distinct from all other species, itself consists of three species-level undescribed taxa ( Fig. 15 red, purple, and orange). The second species ( Fig. 15 purple) with specimens sequenced from Brazil: Bahia and with incomplete or missing data (likely from Southeast Brazil) differs in COI barcode by 2.6% (17 bp) from S. flavicauda sp. n. and by 2.0% (13 bp) from the new species described next. This new species is differentiated from its relatives by narrower than in nearly all other species yellow bands and submarginal macules, discal bands not much wider than submarginal bands and macules, weaker developed (but present) marginal yellow spots inside brown border on the ventral side of wings, including a small spot in the cell M 3 -CuA 1 that does not reach subapical elongated macule, more strongly defined than in other species dark brown area by tornus on the ventral hindwing, mostly dorsally brown abdomen, and larger size, similar to that of many specimens of S. regulus . Due to unexplored phenotypic variation, definitive identification is provided by DNA, and a combination of the following characters is diagnostic in the nuclear genome: cne4191.9.4:T63C, cne 1381.2.3:C702T, cne3677.1.5:C150T, cne3677.1.5:C151T, cne1498. 4.1:C82A and in COI barcode: G200A, T367C, A451C, T526A, T542C.

Barcode sequence of the holotype. Sample NVG-22117C08, GenBank PP254254, 658 base pairs: AACTTTATATTTTATTTTTGGAATTTGAGCAGGTATAATAGGAACATCTCTTAGTTTATTAATTCGAATAGAATTAGGAACTCCTGGATCTTTAATTGGAGATGATCAAATTTATAATACT ATTGTTACAGCTCATGCATTTATTATAATTTTTTTTATAATTATACCTATTATAATTGGAGGATTTGGAAACTGATTAATTCCATTAATATTAGGAGCTCCAGATATAGCTTTCCCCCGTA TAAATAATATAAGATTTTGATTATTACCTCCTTCTTTATTTTTATTAATCTCCAGAAGAATTGTTGAAAATGGAGCAGGAACTGGATGAACAGTGTACCCCCCACTTTCATCTAATATTGC TCACAGAGGAACTTCTGTTGATTTAGCCATTTTTTCTCTTCATTTAGCTGGAATTTCATCAATCTTAGGTGCAATTAATTTTATTACCACTATTATTAATATACGTATTAATAATTTATCA TTTGATCAAATACCTTTATTTGTTTGATCTGTAGGAATTACAGCTCTTCTTCTTTTACTATCATTACCTGTTTTAGCAGGAGCTATTACTATATTACTTACTGATCGAAATTTAAATACAT CTTTTTTTGATCCTGCAGGAGGTGGAGATCCAATTTTATATCAACATTTATTT

Type material. Holotype: ♂ currently deposited in the collection of Museum für Naturkunde, Berlin, Germany [ MFNB], illustrated in Fig. 17b, bears four printed (text in italics handwritten): three white [ Bahia, Para | Sello | Sieber / Hist. Coll. | Nr. 3827] (text after / is on the other side of the label), [ex coll. | H. STICHEL], [DNA sample ID: | NVG-22117C08 | c/o Nick V. Grishin ], and one red [ HOLOTYPE ♂ | Synargis | tenebritorna Grishin]. The 1 st label of the holotype was added during the subsequent curation of historical collections by Andree Salk. Originally, the holotype was an unlabeled specimen in a series with the handwritten header label [Regulus | Fan God Don. | Baeotis Regulus | Wstw | Bah. Sello, Pará Sieb] on the specimen bearing a label with the number 3827 (a paratype of the species described next). Some specimens in this series are from Bahia, and others from Pará. The series consists of two species. The second species (described next) is Amazonian, and we deduce that it was collected in Pará by Friedrich Wilhelm Sieber (1775–1831). Therefore, we hypothesize that this species was collected in Bahia, Brazil, by Friedrich Sello[w] (1789–1831). Paratypes: 1♂ from Brazil, Maassen collection (NVG-21119F09) and 1♀ no data, Weymer collection (NVG-21119F10), both in MFNB.

Type locality. Brazil: Bahia .

Etymology. In Latin, tenebrosus means dark and describes something full of shadows or gloom, emphasizing the atmosphere of darkness. The name is a compound word of tenebrosus and tornus to indicate the dark ventral hindwing tornus. The name is an adjective.

Distribution. Brazil, specifically recorded from Bahia.

http://zoobank.org/ 986F2867-69C7-416F-8B88-FA3092BBFAC6 ( Figs. 15 part, 17c, d)

Definition and diagnosis. Genomic analysis of the S. regulus group reveals a clade that, being distinct from all other species, itself consists of three species-level undescribed taxa ( Fig. 15 red, purple, and orange). The first species ( Fig. 15 orange) with specimens sequenced from French Guiana and Brazil: Pará differs in COI barcode by 2.0% (13 bp) from S. tenebritorna sp. n. from and by 2.6% (17 bp) from S. flavicauda sp. n. This new species is differentiated from its relatives by narrower than in some others yellow bands and submarginal macules, discal band at least twice the width of the submarginal band and macules (the hindwing discal band is even broader comparatively to the submarginal band in the paratype, Fig. 17d), weakly developed marginal yellow spots inside brown border on the ventral side of wings, and the spot in cell M 3 -CuA 1 that is either missing or vestigial at least on the forewing, darker tornal area on ventral hindwing is visible but weaker than in S. tenebritorna sp. n. Males could be with dorsally yellow caudal half of abdomen (yellow ventrally as in other species). Due to unexplored phenotypic variation, definitive identification is provided by DNA, and a combination of the following characters is diagnostic in the nuclear genome: cne1775.24.4:C93A, cne5268.4.1:T390C, cne656.6.1:C168T, cne5798.2.3:T168C, cne 2799.9.1:A501G, cne8392.1.3:G87A, cne5383.1.4:A156G, cne5265.4.1:G5775A, cne11854.1.1:A493G, cne6377.3.2:T159T (not C) and in COI barcode: G87A, A409G, T487C, T526T, T542C.

Barcode sequence of the holotype. Sample NVG-22117C04, GenBank PP254255, 658 base pairs: AACTTTATATTTTATTTTTGGAATTTGAGCAGGTATAGTAGGAACATCTCTTAGTTTATTAATTCGAATAGAATTAGGAACTCCTGAATCTTTAATTGGAGATGATCAAATTTATAATACT ATTGTTACAGCTCATGCATTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGAAACTGATTAGTTCCATTAATATTAGGAGCTCCAGATATAGCTTTTCCCCGTA TAAATAATATAAGATTTTGATTATTACCTCCTTCTTTATTTTTATTAATCTCCAGAAGAATTGTTGAAAATGGAGCAGGAACTGGATGAACAGTGTACCCCCCACTTTCATCCAATATTGC TCATAGAGGAACTTCTGTTGATTTAGCCATTTTTTCTCTTCATTTGGCTGGAATTTCATCAATCTTAGGTGCAATTAATTTTATTACCACTATTATTAATATACGTATTAATAATTTATCA TTCGATCAAATACCTTTATTTATTTGATCAGTAGGAATTACTGCTCTTCTTCTTTTACTATCATTACCTGTTTTAGCTGGAGCTATTACTATATTACTTACTGATCGAAATTTAAATACAT CTTTTTTTGATCCTGCAGGAGGTGGAGATCCAATTTTATATCAACATTTATTT

Type material. Holotype: ♂ deposited in the collection of Museum für Naturkunde, Berlin, Germany [ MFNB], illustrated in Fig. 17c, bears four labels, 2 nd handwritten on glassine paper likely cut out of the envelope that contained this specimen, others printed: three white [French Guyana | Roura, Galion | 28.04.1991 | leg. C. Brévignon], [ 28.IV.1991 | Galion] (has other marks), [DNA sample ID: | NVG-22117C04 | c/o Nick V. Grishin ], and one red [ HOLOTYPE ♂ | Synargis | latidifa Grishin] . Paratype: 1♂ from Brazil: Pará, F. Sieber leg. (NVG-22117C06, GenBank barcode PP254256; the header specimen with the historical collection number label 3827; see the type material section of the previous species for the deduction of the locality of this specimen, Fig. 17d) [ MFNB] .

Type locality. French Guiana: Roura , Galion .

Etymology. In Latin, latitudinum differentia means "difference in width," referring to the widths of the discal (broader) and submarginal (narrow) bands: lati [tudinum]+ dif [ferenti] a. The name is an adjective.

Distribution. Lower Amazonian region; recorded from Brazil: Pará and French Guiana.