Synargis rectanga Grishin, 2025

Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina & Grishin, Nick V., 2025, Advancing butterfly systematics through genomic analysis, The Taxonomic Report of the International Lepidoptera Survey 12 (5), pp. 1-201 : 24-26

Synargis rectanga Grishin , new species

http://zoobank.org/ 00AE0604-72AE-4E6D-B0DD-663BCC892274 ( Figs. 21 part, 22a)

Definition and diagnosis. A female from the Andes of northern Peru ( Fig. 22a ) is sister to Synargis maxidifa Grishin, 2024 ( type locality Peru: Loreto Region, Pumayacú) ( Fig. 22b ), a lowland species, but is genetically differentiated from it ( Fig. 21 ); e.g., their COI barcodes differ by 1.5% (10 bp), and, therefore, represents a new species. This new species differs from its relatives by the following combination of characters: a broad (3–4 times broader than submarginal cream patches and bands) and rather rectangular in shape cream diagonal band through both wings from the end of the forewing discal cell to the inner margin of the hindwing; pale-yellow, cream-colored spots and bands; prominently checkered fringes; somewhat sinuous outer margins of both wings; diffuse and irregular edges of pale submarginal patches and bands; and prominent cream spots crossing the brown border of the ventral side of the wings. Due to the cryptic nature of this species and unexplored individual variation, most reliable identification is achieved by DNA, and a combination of the following base pairs is diagnostic in the nuclear genome: cne3016.1.2:A390G, cne3016.1.2:G402T, cne12689.1.1:G111A, cne457.6.18:G125C, cne 2264.8.5:A189G; and COI barcode: T59A, G125A, T169C, T358C, A494T.

Barcode sequence of the holotype. Sample NVG-23087C05, GenBank PV549986, 658 base pairs: AACTTTATATTTTATTTTTGGAATTTGAGCAGGTATAATAGGAACATCTCTTAGTTTAATAATTCGAATAGAATTAGGAACTCCTGAATCTTTAATTGGAGATGATCAAATTTATAATACT ATTATTACAGCTCATGCATTTATTATAATTTTTTTTATAGTTATACCCATTATAATTGGAGGATTTGGAAATTGATTAGTTCCATTAATATTAGGAGCTCCAGATATAGCTTTCCCCCGTA TAAATAACATAAGATTTTGATTATTACCTCCTTCTTTATTTTTATTAATCTCCAGAAGAATTGTTGAAAATGGTGCAGGAACTGGATGAACAGTGTACCCCCCACTTTCATCAAACATTGC TCATAGAGGAACTTCTGTTGATTTAGCCATTTTTTCTCTTCATTTAGCTGGAATTTCTTCAATCTTAGGTGCAATTAACTTTATTACTACTATTATTAATATACGTATTAATAATTTATCA TTTGATCAATTACCTTTATTTATTTGATCAGTAGGAATTACTGCTCTTCTTCTTTTATTATCATTACCTGTTTTAGCAGGAGCTATTACTATATTACTTACTGATCGAAATTTAAATACAT CTTTTTTTGATCCTGCAGGAGGAGGAGATCCAATTTTATACCAACATTTATTT

Type material. Holotype: ♀ deposited in the Zoologische Staatssammlung München, Germany ( ZSMC), illustrated in Fig. 22a , bears the following four rectangular labels (2 nd handwritten, others printed), three white: [Tarap. | Perú], [♀Nymph. regulus F. | Peru *], [DNA sample ID: | NVG-23087C05 | c/o Nick V. Grishin ], and one red [HOLOTYPE ♀ | Synargis | rectanga Grishin].

Type locality. Peru: San Martin Region, Tarapoto .

Etymology. The name is given for the rectangular shape of a wide cream-colored discal band and its brown frame, and is treated as a noun in apposition.

Distribution. Currently known only from the holotype collected in the lower eastern Andes of Northern Peru.

Figures

Fig. 21. Phylogenetic trees of selected Synargis species constructed from protein-coding regions in: a) the nuclear genome (autosomes), based on 345,000 positions, and b) the mitochondrial genome. Different species are colored differently: S. maxidifa (green), S. rectanga sp. n. (magenta), S. tenebritorna Grishin, 2024 (blue), S. latidifa Grishin, 2024 (purple), and S. flavicauda Grishin, 2024 (cyan with S. flavicauda cosita Grishin, 2024 in olive). Ultrafast bootstrap (Minh et al. 2013) values are shown at nodes. Gaps in terminal branches indicate that a segment of a branch was cut out to reduce its length (to allow an increase in the font size), i.e., a branch with a gap is longer than shown.

Fig. 22. Synargis specimens in dorsal (left) and ventral (right) views, data in text: a) S. rectanga sp. n. holotype ♀ NVG-23087C05 and b) S. maxidifa Grishin, 2024 holotype ♂ NVG-23103C10.