Sumavosporidium sylvestre Tedersoo & Esmaeilzadeh-Salestani, 2025
|
publication ID |
https://doi.org/10.3897/mycokeys.124.161674 |
|
DOI |
https://doi.org/10.5281/zenodo.17398970 |
|
persistent identifier |
https://treatment.plazi.org/id/2E70C63A-1BB0-53A5-B3FC-3A332E8A0A5A |
|
treatment provided by |
|
|
scientific name |
Sumavosporidium sylvestre Tedersoo & Esmaeilzadeh-Salestani |
| status |
sp. nov. |
Sumavosporidium sylvestre Tedersoo & Esmaeilzadeh-Salestani sp. nov.
Diagnosis.
Separation from other species of Sumavosporidium based on ITS 2 (positions 7–31 gaatgaagatgtgatcgaactgtgc; one mismatch allowed) and LSU (positions 465–484 caactagttggccttcaggt; one mismatch allowed) as indicated in Fig. 46 View Figure 46 . Intraspecific variation up to 2.0 % in ITS 2 and up to 0.2 % in LSU. Interspecific distance at least 12.0 % in ITS 2.
Type.
Vouchered soil sample TUE 000381 ( holotype); eDNA sequence UDB 029033 = OZ 253808 ( legitype); eDNA sample TUE 100381 ( nucleotype); GSMc plot S 114, Picea abies dominated forest soil in Šumava , Czechia, 49.017°N, 13.4751°E GoogleMaps .
Description.
Other sequences: UDB 014611 and EUK 0482169 (type locality); UDB 029027 , UDB 029028 and UDB 014612 ( GSMc plot S 121, Fagus sylvatica forest soil in Taunus, Germany, 50.1413°N, 8.2677°E); EUK 0482019 and EUK 0520242 ( GSMc plot S 426, Fagus sylvatica forest soil in Kistrupvang, Denmark, 56.0264°N, 12.3364°E); HQ 022097 (mixed forest soil in Bartlett Experimental Forest, NH, USA, 44.06, – 71.30); EUK 0522425 and EUK 0522433 and ( GSMc plot G 4145, mixed deciduous forest soil in Promised Land, PA, USA, 41.30491, – 75.2021°E); EUK 0523233 ( GSMc plot S 878, Alnus alnobetula tundra soil in Anadyr, Chukotka, Russia, 64.7219°N, 177.4238°E); EUK 0034322 ( GSMc plot G 4713, Tsuga mertensiana forest soil in Crater Lake, OR, USA, 42.9786, – 122.13); and EUK 0521849 ( GSMc plot S 892, forest tundra soil in Arman, Magadan, Russia, 59.6972°N, 150.4118°E).
Etymology.
Šumava (Czech) refers to the type locality, and sylva (Latin) refers to the forest habitat.
Notes.
Found in eight localities in acidic temperate and boreal forest and tundra soils in Europe, Asia, and North America. GlobalFungi reveals seven additional records from forest soil in Europe and one record from an Indonesian oil palm plantation soil.
No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.
|
Kingdom |
|
|
SubKingdom |
Rozellomyceta |
|
Phylum |
|
|
Class |
|
|
Order |
|
|
Family |
|
|
Genus |
