Staphylus ( Scantilla ) bondus A. Warren, H. A. Freeman & Lemes, 2025
|
publication ID |
https://doi.org/10.11646/zootaxa.5609.2.7 |
|
publication LSID |
lsid:zoobank.org:pub:16ED41B5-963F-40D8-8ACB-4AA0F42CDA80 |
|
DOI |
https://doi.org/10.5281/zenodo.15230800 |
|
persistent identifier |
https://treatment.plazi.org/id/03A60F08-FFF3-FF89-9AF6-FA644D77F999 |
|
treatment provided by |
Plazi |
|
scientific name |
Staphylus ( Scantilla ) bondus A. Warren, H. A. Freeman & Lemes |
| status |
sp. nov. |
Staphylus ( Scantilla) bondus A. Warren, H. A. Freeman & Lemes View in CoL , sp. nov.
zoobank.org:act: 059BCA03-7AD8-44EF-A24A-31223D7967E5
( Figs 1–4 View FIGURE 1 View FIGURE 2 View FIGURE 3 View FIGURE 4 , 7 View FIGURE 7 )
Diagnosis. In the male genitalia, the valva is more elongated and narrower when compared with St. ( Sc.) opites , where the valva reassembles a triangle (see pl. 9, fig. 5, in Godman & Salvin, 1896). In addition, the harpe is somewhat oval, while in St. ( Sc.) opites the upper region has two pointed expansions. The fultura inferior bears clusters of small, socketed spines on its lateral sides, which are absent in St. ( Sc.) opites .
Male description ( Fig. 2A–B View FIGURE 2 ). Head ( Fig. 3A–B View FIGURE 3 ): Brown with yellow scales dorsally; white cream ventrally, third segment of palpi slightly darker. Antennae brown dorsally, ventrally with small yellow dots at base of joints. Nudum with 11 segments. Thorax: Brown dorsally, with white hair-like scales ventrally. Legs brown with white hair-like scales and sparse yellow scales. FW length and shape: 16 mm (n = 1). Outer margin rounded. HW length and shape: 12 mm (n = 1). Outer margin undulated. DFW: Brown. Two paler transverse bands in the central and postdiscal areas. Costal fold absent. Presence of few sparse paler scales. Fringe brown. VFW: Lighter brown. Presence of sparse paler scales. Fringe as in DFW. DHW: Brown. Two paler transverse bands in central and postdiscal areas. Presence of few pale scales and long, thin, brown hair-like scales. Fringe brown. VHW: Lighter brown. Presence of sparse yellow scales, predominantly on the inner margin. Abdomen: Unknown [previously dissected]. Genitalia ( Fig. 4 View FIGURE 4 ): Tegumen about as long as wide, rounded proximally, distally with a small excavation at the middle and two lateral triangular processes. Ventral arms of tegumen narrow and fused with dorsal arms of saccus, assuming that the boundary between these structures is at the angle between them. Saccus triangular, short. Fenestra developed. Uncus with base enlarged bearing a tuft of hairs dorsally, distally tubular. Gnathos developed as two sclerotized plates fused ventrally, with fine microtrichia. Valva almost three times longer than wide; sacculus about six times longer than wide, narrow, rectangular, with proximal part wider, with thin socketed spines internally; harpe broad, rounded distally, concave on its proximal upper margin, with thin setae internally and externally, and a cluster of small socketed spines internally at dorsal proximal margin; ampulla almost reaching the harpe, rounded at dorsodistal margin, distal third ventrally straight, then making a convex curvature, with thin setae internally; costa poorly defined. Aedeagus cylindrical, shorter than valva; insertion of manica at the first third; without cornuti; ejaculatory bulb opening broad, dorsal; distal opening for vesica extending dorsodistally. Fultura superior and inferior developed, the inferior with clusters of small, socketed spines directed posteriorly on its lateral sides.
Female description ( Fig. 2C–D View FIGURE 2 ). Female differs from male as follows: FW length. 16 mm (n = 1). HW length. 11 mm (n = 1). Wings slightly lighter than male. Two small white dots on forewing in R 2 -R 3 and R 3 -R 4. Abdomen missing.
Barcode sequence of the holotype. Sample JRAL-COI-13 José R. A. Lemes, Bold Process CMBUT1771-21 , GenBank PV 258742, 658 base pairs [250n]: AACTTTATATTTTATTTTTGGTATTTGATCTGGTATAGTAGGAACTTCTTTAAGTATTCTTATTCGTTCAGAACTA GGAACTCCCGGATCTTTAATTGGAGATGATCAAATTTATAATACTATTGTAACAGCTCATGCTTTTATTNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATTAGTACCTTTAATATTAGGAGCTCCTGATAT AGCTTTTCCTCGAATAAATAATATAAGTTTTTGATTATTACCTCCTTCTCTTATACTTTTAATTTCAAGTAGTATT GTAGAAAATGGAGCAGGTACANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGCTTTA CTTTTACTTTTATCACTATCAGTATTAGCAGGAGCTATTACTATACTTTTAACTGATCGAAATCTTAATACATCAT TTTTTGATCCAGCAGGAGGAGGAGATCCAATTTTATATCAACATTTATTT
Etymology. The name bondus is in reference to the type locality, Bonda, a small village located close to the Manzanares River.
Distribution ( Fig. 7 View FIGURE 7 ). To date, this species is known only from the type locality, Bonda, Magdalena Department, Colombia. The type specimens, while not labeled with day or year of capture (only month), are clearly very old, since they are from the W. J. Holland collection at the CMNH.
Type material. Holotype ( Fig. 2A–B View FIGURE 2 ) male deposited in CMNH with the following labels (lines separated by “/”): Bonda ( 250 ft.) / Dept. Magdalena / Colombia, S. A.; Oct[tober]; Holland / Collection; Genitalia Vial / Number H-1544 / H. A. Freeman; Holotype / Staphylus bondus / A. Warren, H. A. Freeman & Lemes / DNA Voucher JRAL-COI-13 José R. A. Lemes [Process CMBUT1771-21 ] /.
Allotype ( Fig. 2C–D View FIGURE 2 ) female deposited in CMNH with the following labels (lines separated by “/”): Bonda ( 250 ft.) / Dept. Magdalena / Colombia, S. A.; Sept[ember]; Holland / Collection; Allotype / Staphylus bondus / A. Warren, H. A. Freeman & Lemes .
| R |
Departamento de Geologia, Universidad de Chile |
| CMNH |
The Cleveland Museum of Natural History |
No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.
|
Kingdom |
|
|
Phylum |
|
|
Class |
|
|
Order |
|
|
Family |
|
|
SubFamily |
Pyrginae |
|
Genus |
