Spioniades artemis Grishin, 2023
publication ID |
https://doi.org/ 10.5281/zenodo.10396362 |
persistent identifier |
https://treatment.plazi.org/id/03810139-FFC4-BB4C-C0CA-FA51E125B098 |
treatment provided by |
Felipe |
scientific name |
Spioniades artemis Grishin |
status |
sp. nov. |
Spioniades artemis Grishin , new species
https://zoobank.org/ 994E86A1-7BEF-42D2-807F-8DC7623058E6
( Fig. 2 part, 57–58, 268–270)
Definition and diagnosis. Phylogenetic analysis reveals that Central American specimens identified as Spioniades artemides (Stoll, 1782) (type locality in Suriname) are genetically differentiated from it ( Fig. 2): e.g., their COI barcodes differ by 5.5% (36 bp), and therefore represent a new species. This new species keys to S. artemides (E.14.2) in Evans (1953) and differs from it and another new species described below by a combination of the following characters: a more regular, straight, and diffuse border between discal brown and postdiscal white area on the hindwing, lack of pale diffuse spot(s) towards inner margin and tornus of the ventral forewing, nearly evenly convex (not angled at vein CuA 1) forewing outer margin ( Fig. 57–58), more robust uncus in lateral view, narrower in dorsal view, deeper divided harpe with more concave distal margin in lateral view and protruding less inward in dorsal view, more concave in the middle, wavy costa with a narrower knob-like process that protrudes deeper inward ( Fig. 268–270). Due to the cryptic nature of this species, most reliable identification is achieved by DNA and a combination of the following base pairs is diagnostic in the nuclear genome: aly378.30.2:A75G, aly1838.60.2:A36G, aly1838.60.2:A126G, aly294.15.14:C81T, aly274.33.1:G1047A, and COI barcode: T50C, T127A, T529C, A541G, T547C.
Barcode sequence of the holotype. Sample NVG-19088B03, GenBank OR837647, 658 base pairs: AACTTTATATTTTATTTTTGGAATTTGAGCAGGAATAGTAGGAACTTCTCTAAGTTTATTAATTCGAACTGAATTAGGAAATCCTGGAGCTCTTATT GGAGATGATCAAATTTATAATACTATTGTAACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGAAATT
GATTAGTTCCATTAATGCTAGGAGCCCCTGATATAGCATTCCCTCGAATAAATAATATAAGATTCTGATTATTACCTCCATCTTTAATATTACTAAT TTCTAGAAGAATCGTTGAAAATGGAGCAGGTACTGGATGAACAGTTTACCCCCCTCTTTCAGCTAATATCGCACACCAAGGATCTTCAGTTGATTTA GCAATTTTTTCTTTACATCTTGCTGGAATTTCCTCTATTTTAGGAGCTATTAATTTTATTTCTACAATTATTAATATACGAATTAGAAATCTTTCAT TTGATCAAATACCATTATTTGTTTGAGCTGTAGGAATTACTGCCTTACTTTTATTGTTATCCTTACCAGTATTAGCAGGTGCTATTACTATACTTTT AACTGATCGAAATCTTAATACATCATTTTTTGATCCTGCTGGAGGAGGAGATCCAATTTTATATCAACATTTATTT
Type material. Holotype: ♂ deposited in the National Museum of Natural History , Smithsonian Institution, Washington, DC, USA ( USNM), illustrated in Fig. 57–58, bears the following four rectangular labels, three white: [Madden For. | Panama C.Z. | IV-4-64], [DNA sample ID: | NVG-19088B03 | c/o Nick V. Grishin], [USNMENT | {QR Code} | 01588916], and one red [HOLOTYPE ♂ | Spioniades | artemis Grishin ] . Paratypes: 1♂ and 1♀: Costa Rica: Area de Conservación Guanacaste, Alajuela Prov.: 1♂ NVG-18013H11, 10-SRNP-67995 Sector Rincon Rain Forest, Palomo , 96 m, 10.96187, -85.28045, eclosed on 04-Nov-2010 GoogleMaps ; and 1♀ NVG-18013H10, 07-SRNP-65617 Brasilia, Piedrona , 340 m, 11.01618, -85.35902, eclosed on 13-Oct-2007 GoogleMaps .
Type locality. Panama: Panama Province, Madden Road Forest Preserve.
Etymology. The name formed from its sister species, artemides , made shorter for this more northern species. The name is a noun in apposition.
Distribution. Costa Rica and Panama.
USNM |
Smithsonian Institution, National Museum of Natural History |
V |
Royal British Columbia Museum - Herbarium |
No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.
Kingdom |
|
Phylum |
|
Class |
|
Order |
|
Family |
|
Genus |