Solivorax pantropicus Tedersoo, 2025

Tedersoo, Leho, Hosseyni Moghadam, Mahdieh S., Panksep, Kristel, Prins, Victoria, Anslan, Sten, Mikryukov, Vladimir, Bahram, Mohammad, Abarenkov, Kessy, Kõljalg, Urmas, Esmaeilzadeh-Salestani, Keyvan, Pawłowska, Julia, Wurzbacher, Christian, Ding, Yi, Alkahtani, Saad Hussin & Nilsson, R. Henrik, 2025, Thirty novel fungal lineages: formal description based on environmental samples and DNA, MycoKeys 124, pp. 1-121 : 1-121

Solivorax pantropicus Tedersoo sp. nov.

Diagnosis.

Separation from other species of Solivorax based on ITS 2 (positions 273–292 gtctgaccgaaatatctgaa; one mismatch allowed) and LSU D 2 (positions 672–691 gcctgctatgctagcgccgc; one mismatch allowed) as indicated in Fig. 16 . Intraspecific variation up to 2.4 % in ITS 2. Interspecific distance at least 8.2 % in ITS 2 and 6.2 % in LSU.

Type.

Vouchered soil sample TUE 000167 ( holotype); eDNA sequence UDB 014650 = OZ 253792 ( legitype); eDNA sample TUE 100167 ( nucleotype); GSMc plot G 2750, tropical forest soil in Douglas Hot Springs , NT, Australia, –13.7655, 131.4395 .

Description.

Other sequences: EUK 0484226 ( GSMc plot S 1278, Eucalyptus plantation soil near Durban, South Africa, –29.7502, 30.7419); EUK 0331319 ( GSMc plot G 5027, subtropical swamp forest soil in Deweyville, LO, USA, 30.3076°N, 93.7304°E); EUK 0331320 ( GSMc plot S 915, tropical dry forest soil in Rancho Calimayor, Mexico, 16.5461, –93.8828); EUK 0331312 ( GSMc plot G 5687, tropical garden soil in Kakamega, Kenya, 0.2866°N, 34.7673°E); EUK 0331316 ( GSMc plot JYK 054, Eucalyptus plantation soil in Bome, Liberia, 6.5245, –10.8400); EUK 0331318 ( GSMc plot S 1267, tropical rainforest soil in Khong Ngam, Thailand, 19.6691°N, 99.8199°E); and EUK 0331314 ( GSMc plot G 5068, tropical rainforest soil in Quixada, Brazil, 4.8876, –39.0461).

Etymology.

Solum and vorax (Latin) refer to soil devouring, and pantropicos (Greek) refers to widespread distribution across tropical regions.

Notes.

Found in tropical and subtropical forest soils worldwide (n = 23 records). The 17 additional GlobalFungi records confirm the tropical distribution and indicate potential colonization of plant roots (2 records).

Figures

Figure 16. Diagnostic nucleotide sequences of Solivorax pantropicus relative to the closest related species in ITS 2 and LSU. Numbers indicate positions in the legitype (marked with an asterisk).