Ruderalia cosmopolita Tedersoo, 2025
|
publication ID |
https://doi.org/10.3897/mycokeys.124.161674 |
|
DOI |
https://doi.org/10.5281/zenodo.17398912 |
|
persistent identifier |
https://treatment.plazi.org/id/A73530CC-E521-5BD5-874C-FF06EA9B533E |
|
treatment provided by |
|
|
scientific name |
Ruderalia cosmopolita Tedersoo |
| status |
sp. nov. |
Ruderalia cosmopolita Tedersoo sp. nov.
Diagnosis.
Separation from other species of Ruderalia based on ITS 2 (positions 154–176 ggaggcttgaaattgagaaaaag; one mismatch allowed) and LSU D 2 (positions 583–607 cctcgggaatgtgatccgcctttac; one mismatch allowed) as indicated in Fig. 36 View Figure 36 . Intraspecific variation up to 9.8 % (including up to 7 % in the type locality) in ITS 2 due to multiple microsatellite-like repeats and long homopolymers and up to 1.5 % in LSU. Interspecific distance> 20 % in ITS 2.
Type.
Vouchered soil sample TUE 028393 ( holotype); eDNA sequence EUK 1138161 = OZ 253804 ( legitype); eDNA sample TUE 128393 ( nucleotype); GSMc plot G 5804, wasteland soil in Tartu, Estonia, 58.3816°N, 26.6916°E GoogleMaps .
Description.
Other sequences: EUK 1137942 , EUK 1137899 and EUK 1124460 (type locality); EUK 0018130 ( GSMc plot S 150, Quercus woodland soil in Jamestown, CA, USA, 37.8489, –120.581); EUK 0531861 (temperate grassland soil in Murrietta, CA, USA, 33.5319, – 117.2492°E), EUK 0015594 ( GSMc plot EO 077, Cistus shrubland soil in Essouira, Morocco, 31.5136, – 9.6542°E); EUK 0531686 ( GSMc plot G 6066, subtropical Vachellia desert soil in Al Mudawih, Saudi Arabia, 25.8411°N, 39.2793°E); EUK 0531846 ( GSMc plot G 6106, cropland soil in Betas, Iraqi Kurdistan, 37.0588°N, 42.7622°E); EUK 0531869 ( GSMc plot G 5748, subtropical forest soil in Cebollati, Uruguay, – 33.8292, – 54.7672°E); and EUK 0531757 (subtropical shrubland soil in Los Panguiles, Chile, – 33.3822, – 70.9636°E).
Etymology.
Rudus (Latin) refers to a common habitat in early successional land, and cosmopolites (Greek) refers to the global distribution.
Notes.
Found exclusively in soil in multiple habitats of Europe, Asia, North America, South America, and North Africa, with most records from anthropogenic and semidry shrubland habitats (n = 25 records). The 22 additional GlobalFungi records (21 from soil) support these findings.
No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.
|
Kingdom |
|
|
SubKingdom |
Mucoromycota |
|
Phylum |
|
|
Class |
|
|
Order |
|
|
Family |
|
|
Genus |
