Phaenoglyphis belizini Pujade-Villar, 2018

Vogel, Jonathan, Peters, Ralph S., Selfa, Jesús & Ferrer-Suay, Mar, 2024, Characterising the north-western European species of Phaenoglyphis Förster, 1869 (Hymenoptera: Figitidae: Charipinae) with novel insights from DNA barcode data, Biodiversity Data Journal 12, pp. e 120950-e 120950 : e120950-

Phaenoglyphis belizini Pujade-Villar, 2018

Materials

Type status: Other material. Occurrence: recordedBy: GBOL III; individualCount: 1; sex: female; disposition: in collection; occurrenceID: 89B521B3-36C3-527D-BEEC-EE92BCFA83CB; Taxon: family: Figitidae ; genus: Phaenoglyphis ; specificEpithet: belizini ; scientificNameAuthorship: Pujade-Villar, 2018; Location: country: Germany; countryCode: DE; stateProvince: Hesse; municipality: Waldeck-Frankenberg; locality: National park Kellerwald-Edersee, Maierwiesen ; verbatimElevation: 363 m; decimalLatitude: 51.1552; decimalLongitude: 9.0011; Identification: identifiedBy: Mar Ferrer-Suay; dateIdentified: 2023; Event: eventID: 1034; samplingProtocol: Malaise trap (Krefeld type); eventDate: 2021-6 / 7 - 22 / 8; year: 2018; Record Level: language: en; institutionID: ZFMK; collectionID: ZFMK-TIS- 2632436; basisOfRecord: PreservedSpecimen

Type status: Other material. Occurrence: recordedBy: Kothe, T.; Engelhardt, M.; König, Ch.; individualCount: 1; sex: female; disposition: in collection; occurrenceID: 4C1819E8-BC2D-5A9D-BFB2-85937D258A84; Taxon: family: Figitidae ; genus: Phaenoglyphis ; specificEpithet: belizini ; scientificNameAuthorship: Pujade-Villar, 2018; Location: country: Germany; countryCode: DE; stateProvince: Baden-Württemberg; municipality: Tübingen; locality: Wurmlingen, Gengental ; verbatimElevation: 377 m; decimalLatitude: 48.5131; decimalLongitude: 8.9923; Identification: identifiedBy: Mar Ferrer-Suay; dateIdentified: 2023; Event: eventID: 181; samplingProtocol: Malaise trap; eventDate: 2014-5 / 6 - 23 / 6; year: 2018; Record Level: language: en; institutionID: ZFMK; collectionID: ZFMK-TIS- 2640663; basisOfRecord: PreservedSpecimen

Type status: Other material. Occurrence: recordedBy: GBOL III; individualCount: 1; sex: female; disposition: in collection; occurrenceID: 989AEF1E-93A9-5A88-83F4-309A0EDB5B88; Taxon: family: Figitidae ; genus: Phaenoglyphis ; specificEpithet: belizini ; scientificNameAuthorship: Pujade-Villar, 2018; Location: country: Germany; countryCode: DE; stateProvince: Hesse; municipality: Waldeck-Frankenberg; locality: NP Kellerwald-Edersee, " Maierwiesen " ; verbatimElevation: 365 m; decimalLatitude: 51.1555; decimalLongitude: 9.0015; Identification: identifiedBy: Mar Ferrer-Suay; dateIdentified: 2023; Event: eventID: 1295; samplingProtocol: Malaise trap; eventDate: 2021-6 - 8 / 22; year: 2018; Record Level: language: en; institutionID: ZFMK; collectionID: ZFMK-TIS- 2640974; basisOfRecord: PreservedSpecimen

Diagnosis

Female antennae with rhinaria beginning on F 3, pedicel longer than F 1, F 1 slightly longer than F 2, F 2 shorter than F 3 (Fig. 3 a); pronotal carinae present, notauli absent, scutellar foveae present, oval, separated by median carina and almost completely defined (upper part with weak impression) (Fig. 4 a), propodeal carinae present; radial cell closed, 2.7 times as long as wide.

Molecular characterisation

Maximum barcode-distance within species: 2.5 % (3).

Minimum barcode-distance to closest species: 6.3 % ( P. villosa )

Consensus barcode sequence (652 bp):

5 ’ - AATTTTATATTTTATTTTTGGAATTTGGTCAGGAATAATTGGATCTGCTTTAAGAATAATTATTCGTATAGAATTAGGAACTCCATCACAACTTATTGGAAATGATCAAATTTATAATTCAATTGTTACAGCTCATGCTTTTATTATAATTTTTTTTATAGTAATACCTATTATAGTTGGAGGATTTGGAAATTATTTAGTTCCTTTAATATTATCAGCTCCAGATATAGCATTTCCTCGTCTTAATAATATAAGATATTGATTATTATTACCAGCTTTAATTTTATTAGTATCAAGAATATTTATTGATCAAGGAGCAGGAACAGGGTGAACAGTCTATCCTCCTTTATCTTCAAATTTAAGACATTCAGGAATTTCTGTTGATTTAACAATTTTTGCTTTACATTTAAGAGGAGTTTCTTCAATTTTAGGAGCTATTAATTTTATTACAACAATTTTAAATATACGAGTAATTTCAATAGATAAAATTTCTTTATTTATTTGATCAATTTTTTTAACAACTATTTTATTATTATTATCTTTACCAGTTTTAGCTGGAGGTATTACAATATTATTATTTGATCGTAATATAAATACTTCATTTTTTGATCCAATAGGAGGAGGGGATCCAATTCTTTACCAACATTTATTT- 3 ’

Distribution

China: Beijing province ( Ferrer-Suay et al. 2023). New record from Germany: Baden-Württemberg, Hesse.

Figures

Figure 3. SEM images of female Phaenoglyphis antennae (all images show corresponding holotypes): a P. belizini; b P. evenhuisi; c P. longicornis; d P. salicis; e P. stricta; f P. villosa; g P. xanthochroa. Images are taken from Ferrer-Suay et al. (2019).

Figure 4. SEM images of Phaenoglyphis mesoscutum (dorsal view; all images show corresponding holotypes): a P. belizini; b P. evenhuisi; c P. longicornis; d P. salicis; e P. stricta; f P. villosa; g P. xanthochroa. Images are taken from Ferrer-Suay et al. (2019).