Palomastix lacustris Tedersoo, 2025

Tedersoo, Leho, Hosseyni Moghadam, Mahdieh S., Panksep, Kristel, Prins, Victoria, Anslan, Sten, Mikryukov, Vladimir, Bahram, Mohammad, Abarenkov, Kessy, Kõljalg, Urmas, Esmaeilzadeh-Salestani, Keyvan, Pawłowska, Julia, Wurzbacher, Christian, Ding, Yi, Alkahtani, Saad Hussin & Nilsson, R. Henrik, 2025, Thirty novel fungal lineages: formal description based on environmental samples and DNA, MycoKeys 124, pp. 1-121 : 1-121

Palomastix lacustris Tedersoo sp. nov.

Diagnosis.

Separation from other species of Palomastix based on ITS 2 (positions 225–244 ctaaaagtcgggtttgattt; one mismatch allowed) and ITS 1 (positions 464–483 cagcaggtcttgactgactt; one mismatch allowed) as indicated in Fig. 24 . Intraspecific variation up to 1.4 % in ITS 2. Interspecific distance at least 9.2 % in ITS 2.

Type.

Vouchered sediment sample TUE 030088 ( holotype); eDNA sequence EUK 1123686 = OZ 253797 ( legitype); eDNA sample TUE 130088 ( nucleotype); FunAqua lake sediment sample W 0021 s; Palojärv , Estonia, 58.0830°N, 26.9143°E .

Description.

Other sequences: EUK 0320710 and EUK 0574068 (type locality); EUK 0320711 , EUK 0320713 (FunAqua lake sediment sample in Viitna Pikkjärv, Estonia, 59.4469°N, 26.0107°E); and EUK 0320712 (FunAqua lake sediment sample W 0992 s in Svartkulpen, Norway, 59.9741°N, 10.7373°E).

Etymology.

> Palo (Estonian) refers to the type locality, Lake Palojärv; lacustris refers to habitat in lakes.

Notes.

Found in sediment samples in Northern Europe (n = 3). There are no records in GlobalFungi.

Figures

Figure 24. Diagnostic nucleotide sequences of Palomastix lacustris relative to the closest related species in ITS 2. Numbers indicate positions in the legitype (marked with an asterisk).