Mycosocceria estonica Tedersoo, Bahram & Esmaeilzadeh-Salestani, 2025

Tedersoo, Leho, Hosseyni Moghadam, Mahdieh S., Panksep, Kristel, Prins, Victoria, Anslan, Sten, Mikryukov, Vladimir, Bahram, Mohammad, Abarenkov, Kessy, Kõljalg, Urmas, Esmaeilzadeh-Salestani, Keyvan, Pawłowska, Julia, Wurzbacher, Christian, Ding, Yi, Alkahtani, Saad Hussin & Nilsson, R. Henrik, 2025, Thirty novel fungal lineages: formal description based on environmental samples and DNA, MycoKeys 124, pp. 1-121 : 1-121

Mycosocceria estonica Tedersoo, Bahram & Esmaeilzadeh-Salestani sp. nov.

Diagnosis.

Separation from other species of Mycosocceria based on ITS 2 (positions 338–357 agaactttgttctttttaac; one mismatch allowed) and LSU D 2 (positions 466–485 aatctggtcccggtggatgg; one mismatch allowed) as indicated in Fig. 32 . Intraspecific variation up to 2.3 % in ITS 2 and 0.2 % in LSU. Interspecific distance at least 10.2 % in ITS 2 and 10.3 % in LSU.

Type.

Vouchered soil sample TUE 028391 ( holotype); eDNA sequence EUK 1124462 = OZ 253802 ( legitype); eDNA sample TUE 128391 ( nucleotype); GSMc plot G 5802, football field in Veeriku , Estonia, 58.3745°N, 26.6855°E .

Description.

Other sequences: EUK 1603994 ( GSMc plot G 5816, Trifolium pratense cropland soil in Hermani, Estonia, 58.8071°N, 25.7564°E); EUK 1008618 ( GSMc plot G 4599, Ulmus laevis forest soil in Liutsepa, Estonia, 58.0791°N, 26.0094°E); EUK 0331576 ( GSMc plot G 5820, Acer - Fraxinus - Ulmus woodland soil in Pajusi, Estonia, 58.7052°N, 25.9389°E); EUK 0331575 ( GSMc plot G 5422, Pinus strobus woodland soil in Tartu, Estonia, 58.3909°N, 26.6973°E); EUK 0331574 ( GSMc plot G 5765 y, grassland soil in Rebaste, Estonia, 58.41°N, 25.93°E); EUK 0331573 (urban park soil in Slovenia); and EUK 0331572 ( GSMc plot S 950, forest tundra soil in Mt. Mayak, Altai kray, Russian Federation, 51.0474°N, 82.9718°E).

Etymology.

Soccer (English) refers to the football field where the type specimen was collected; and estonica (Latin) refers to Estonia, where this species’ type and most additional materials originate.

Notes.

All but one of the 40 records and all five GlobalFungi records are derived from soil. Found mainly in North Eurasia, with occasional records elsewhere.

Figures

Figure 32. Diagnostic nucleotide sequences of Mycosocceria estonica relative to the closest related species in ITS 2 and LSU. Numbers indicate positions in the legitype (marked with an asterisk).