Maerjamyces jumpponenii Tedersoo & Esmaeilzadeh-Salestani, 2025

Tedersoo, Leho, Hosseyni Moghadam, Mahdieh S., Panksep, Kristel, Prins, Victoria, Anslan, Sten, Mikryukov, Vladimir, Bahram, Mohammad, Abarenkov, Kessy, Kõljalg, Urmas, Esmaeilzadeh-Salestani, Keyvan, Pawłowska, Julia, Wurzbacher, Christian, Ding, Yi, Alkahtani, Saad Hussin & Nilsson, R. Henrik, 2025, Thirty novel fungal lineages: formal description based on environmental samples and DNA, MycoKeys 124, pp. 1-121 : 1-121

Maerjamyces jumpponenii Tedersoo & Esmaeilzadeh-Salestani sp. nov.

Diagnosis.

Separation from other species of Maerjamyces based on ITS 2 (positions 43–75 atacctgtttgagtaccatattcttttcccttt; one mismatch allowed) and LSU D 1 (positions 233–252 ttgcactcgtgggttatgta; one mismatch allowed) as indicated in Fig. 34 . Intraspecific variation up to 5.4 % in ITS 2 and up to 1.6 % in LSU. Closest species differ by at least 7.4 % in ITS 2 and 5.0 % in LSU.

Type.

Vouchered soil sample TUE 002272 ( holotype); eDNA sequence EUK 1138158 = OZ 253803 ( legitype); eDNA sample TUE 102272 (nucleotype); GSMc plot G 5295, Pinus mugo plantation soil in Märja , Estonia, 58.3592°N, 26.6443°E .

Description.

Other sequences: EUK 1138156 ( GSMc plot G 5235, Larix decidua plantation soil in Rõõmu, Estonia, 58.3835°N, 26.7742°E); EUK 1138160 ( GSMc plot G 5803, urban park soil in Toomemägi, Estonia, 58.3786°N, 26.7185°E); EUK 1138157 ( GSMc plot G 5283, Quercus robur plantation in Rahinge, Estonia, 58.3845°N, 26.5943°E); MT 277862 (book paper in Turin, Italy); OU 939288 (Kungsängen, Sweden, 59.837°N, 17.661°E); ( GSMc plot G 4800, Ulmus laevis forest soil in Tuhkja, Estonia, 58.4159°N, 25.2326°E); and EUK 1138159 (urban soil in Tartu, Estonia, 58.3913°N, 26.6965°E).

Etymology.

Maerjamyces refers to the type locality in Märja (Estonian), and mykos (Greek) stands for a fungus; Jumpponen (Finnish) refers to Ari Jumpponen, who was the first to collect material of this species ( FJ 780627; Jumpponen et al. 2010).

Notes.

Found mainly in soil (90.4 %) but also from sediments, water, and paper samples (260 total records). Occurs on all continents, but> 95 % of records originate from the temperate and Mediterranean biomes of the Northern Hemisphere. Out of 244 GlobalFungi records, 98.4 % are derived from soil.

Figures

Figure 34. Diagnostic nucleotide sequences of Maerjamyces jumpponenii relative to the closest related species in ITS 2 and LSU. Numbers indicate positions in the legitype (marked with an asterisk).