Lyela myops tashkumirica, Lukhtanov, 2024

Lukhtanov, Vladimir A., 2024, Distribution and geographical differentiation of the Central Asian endemic species Lyela myops (Staudinger, 1881) (Lepidoptera, Nymphalidae, Satyrinae), Ecologica Montenegrina 73, pp. 46-53 : 48-52

Lyela myops tashkumirica ssp. nova.

https://zoobank.org/ urn:lsid:zoobank.org:act:F4E31397-4CA6-4EB7-9766-2C0DB19C3D37

Figs 1, 2 , 7, 8

Holotype: male, Kyrgyzstan, Jalal-Abad Region , near Tashkumir, 41.40°N, 72.24°E, 600 m, 3 May 1996, V. Lukhtanov leg., in ZISP.

Paratypes: 29 males, 11 females, same data, in ZISP . 34 males, 6 females, same locality, 28 Apr 1996, V. Lukhtanov and A.Lukhtanov leg. , in ZISP. 15 males, 6 females, Kyrgyzstan Jalal-Abad Region , near Tashkumir, 41.417°N, 72.233°E, 650 m, 3 May 1996, V. Lukhtanov leg. in ZISP and MGCLB. 7 males, 5 females, Kyrgyzstan Jalal-Abad Region , near Tashkumir 41.40°N, 72.24°E, 600m, 4 May 1996, V. Lukhtanov leg. , in ZISP. 2 males (samples LOWA-789 and LOWA-790), Kyrgyzstan, Jalal-Abad Region , near Tashkumir, 41.483°N, 72.267°E, 1100m, 6 May 1996, V. Lukhtanov leg. , in MGCLB.

Description

The length of the fore wings in the holotype is 21.5 mm, in male paratypes 20.5-23.5 mm, in female paratypes 22-24 mm. Antennae, palps, ocelli, head, thorax and abdomen do not appear to have taxonomically valuable characters for separating subspecies.

Male

The upperside of the forewings is ochre-brown with wide dark brown margins. The costal margin of the fore wings is dusted with white. The single apical ocellus is round, brown, the same color as the margin of the wings, without a white center. The fringe is light gray inside, gray outside.

The upper side of the hindwings is dark brown, without bands and ocelli. The fringe is light gray inside, gray outside.

The underside of the forewings is ochre-brown with wide dark brown margins. The single apical ocellus is round, black, centered by a white dot and surrounded by a narrow yellow border. The area between the apical ocellus and the wing apex is dusted with light gray. The fringe is light gray inside, gray outside.

The underside of the hindwings is gray-brown with a wide dark brown median band. The outer edge of the median band has an uneven, irregular outline. The basal part of the hindwings has areas of lighter gray. There are 6-7 small submarginal ocelli. These ocelli are light gray, centered by a gray-black dot. The area between the median band and the ocelli is lighter than the main background of the wing. The fringe is light gray inside, gray outside.

Female

Wings are more extended than in males. The general coloring is similar, nearly identical to that of male, but the ochre-brown fields of the fore wings is more extended and the dark brown margins are narrower. On the fore wings, the apical ocellus is larger, especially on the underside of the wings, with 1-2 additional small submarginal ocelli.

Mitochondrial DNA barcodes

All 6 samples studied have an identical DNA barcode sequence: GACATTATATTTTATTTTTGGAATTTGAGCAGGTATAGTTGGAACATCTCTTAGTTTAATC ATTCGAACTGAATTAGGTAATCCAGGATCTTTAATTGGAGATGATCAAATTTATAATACT ATTGTTACAGCCCATGCTTTTATTATAATTTTTTTTATAGTTATACCAATTATAATTGGAGG ATTTGGTAATTGATTAGTCCCCCTTATATTAGGAGCCCCTGATATAGCTTTTCCACGAATA AATAACATAAGTTTTTGACTTTTACCCCCCTCATTAATTCTCTTAATTTCAAGTAGTATTGT AGAAAATGGAGCAGGAACTGGATGAACTGTTTACCCCCCCCTTTCTTCTAATATTGCTCAT GGAGGGTCTTCTGTTGATCTTGCTATTTTTTCTCTCCACTTAGCAGGTATTTCCTCAATTTT AGGAGCTATTAATTTTATTACTACAATTATTAATATACGAGTGAATGGAATATCATATGAT CAAATACCTTTATTTGTATGAGCTGTTGGAATTACTGCTTTACTTTTACTTCTCTCATTACC

TGTATTAGCAGGAGCTATTACCATACTTCTTACAGACCGAAATTTAAATACTTCCTTTTTT GACCCTGCAGGAGGAGGAGATCCTATTTTATATCAACATTTATTT.

This sequence differs by 40 nucleotide substitutions from the known DNA barcode of Lyela myops tekkensis (EU920741, voucher CP16-22). The uncorrected p-distance between these subspecies is 6.1%.

Male genitalia

The male genitalia were studied and compared with published images for L. myops tekkensis ( Leestmans & Karbalaye 1998) and L. myops myops ( Korb & Bolshakov 2011) . No noticeable differences were found from the genitalia depicted in these works.

Distribution

Known only from the type locality and two other places close to the type-locality ( Fig. 13 ). Probably, the distribution area of the new subspecies also includes other parts of the Fergana Valley, which are noted in the literature ( Leestmans & Karbalaye 1998, Tshikolovets 2000, 2005). If the subspecies identity of the specimens from south Fergana is confirmed, this will mean an expansion of the range of L. myops tashkumirica to the south and west of the type locality.

Etymology. The name is toponymic. Tashkumir (also known as Tashkumyr and Tash-Kömür) is the town of Jalal-Abad Region in Southern Kyrgyzstan.

Diagnosis

If we compare all the subspecies of L. myops , it is easy to notice that the Iranian-Turkmen subspecies L. myops tekkensis represents the most differentiated form, sharply distinguished from other subspecies by the greatly reduced size of the red-brown field on the fore wings of both sexes. In L. myops tekkensis , this field ends at the level of the apical ocellus, while in other subspecies it is extended towards the outer edge of the wing. The deep divergence of this subspecies is also confirmed by the differentiation of mitochondrial DNA barcodes, which we discovered when comparing L. myops tekkensis with L. myops tashkumirica . The uncorrected p-distance between these taxa is more than 6%, which even exceeds the standard threshold (2-3%), usually characterizing closely related species ( Hubert & Hanner 2015; Young et al. 2017; Phillips et al. 2022). Thus, the strong morphological and genetic hiatus between L. myops tashkumirica from L. myops tekkensis is beyond any doubt.

Unfortunately, the lack of molecular data for other subspecies, with the exception of L. myops tekkensis and L. myops tashkumirica , does not allow for their molecular comparison, but a serious differentiation of L. myops tashkumirica from other subspecies is evidenced by a whole complex of different features. Lyela myops tashkumirica differs from the nominotypical subspecies ( Figs 3, 4 , 9, 10 ) and from L. myops mangystavica in the following characters. In L. myops tashkumirica , butterflies of both sexes, are much larger in size. The length of the fore wing in L. myops tashkumirica is 20.5−23.5 mm in males and 22-24 mm in females, while in L. myops myops and L. myops mangystavica it is 14- 19.5 in males and 16-20 in females. In L. myops tashkumirica , the costal margin of the forewing is more convex, and the apex of the forewing is more rounded. The red-brown field on the front wings is smaller in size and has a more diffuse border with the black-brown edge of the wing. The marginal black-brown band on the forewing is wider. The underside of the hind wing is less contrasting, with a wider median band.

Lyela myops tashkumirica has the greatest external resemblance to L. myops babatagi ( Figs 5, 6 , 11, 12 ) primarily due to the same large size, but differs in a more rounded forewing apex, a brighter whitish hair on the costal edge of the upper side of the forewing in males, and an apical part of the forewing underside, which is dustier with whitish scales. In L. myops tashkumirica this dusty area extends to the apical ocellus, while in L. myops babatagi the apical ocellus is completely surrounded by a main ochre-brown background color. The underside of the hind wings of L. myops tashkumirica is more contrasting with a clear light field between the outer edge of the median band and a number of submarginal ocelli. In L. myops tashkumirica this light field is strewn with small gray dots, while in L. myops babatagi this area is covered with numerous rather long black-brown streaks. In L. myops tashkumirica , the outer edge of the median band on the underside of the hind wing has an uneven, irregular outline, while in L. myops babatagi this edge is wavy.

Figures

Figure 13. Map of Kyrgyzstan showing the distribution of L. myops tashkumirica. Question marks indicate records whose subspecies identity need to be clarified.

Figures 1-6. Lyela myops, males. 1, 3, 5, upperside. 2, 4, 6, underside. 1, 2, L. m. tashkumirica, holotype, Kyrgyzstan, Jalal-Abad Region, near Tashkumir, 41.40°N, 72.24°E, 600 m, 3 May 1996, V.Lukhtanov leg., in ZISP. 3,4, L. m. myops, Kazakhstan, East Kazakhstan Region, Kurchum Range (SW extreme part), Arka-Aul Mts, 48.4311°N, 83.9792°E, 490m, 30 April 2019, V.A.Lukhtanov, in ZISP. 5,6, L. myops babatagi, Turkmenistan, Kugitang Mts, Svinzovy Rudnik, 1400 m, 28 April 1989, V.Lukhtanov leg., in ZISP.

Figures 7-12. Lyela myops, females. 7, 9, 11, upperside. 8, 10, 12, underside. 7, 8, L. m. tashkumirica, paratype, Kyrgyzstan, Jalal-Abad Region, near Tashkumir, 41.40°N, 72.24°E, 600 m, 3 May 1996, V.Lukhtanov leg., in ZISP. 9, 10, L. m. myops, Kazakhstan, Jetisu Region (=Taldy-Kurgan Region), Koybyn Valley, 44.21449°N, 79.50230°E, 1048m, 30 April 2021, V.A.Lukhtanov leg., in ZISP. 11, 12, L. m. babatagi, Turkmenistan, Kugitang Mts, Svinzovy Rudnik, 1400 m, 28 April 1989, V.Lukhtanov leg., in ZISP.