Leurus sondrawardae Zuñiga & Valerio, 2024

Zuñiga, Ronald, Valerio, Alejandro A., Hanson, Paul, Smith, M. Alex, Hallwachs, Winnie & Janzen, Daniel H., 2024, Cryptic diversity of Leurus wasps (Hymenoptera: Ichneumonidae: Metopiinae), parasitoids of caterpillars in Area de Conservación Guanacaste, Costa Rica, Zootaxa 5529 (3), pp. 511-531 : 528-529

Leurus sondrawardae Zuñiga & Valerio , sp. nov.

( Fig. 11 )

Diagnostic description. Female. Fore wing length, 5.2−5.6 mm (holotype 5.2 mm). Malar space 0.8−1.1 × basal mandibular width; antenna with 23–24 flagellomeres, most flagellomeres quadrate, except for the first 2 and the last 2–3. Coloration. Antennal scape brown, pedicel brown, flagellum brownish; tegula predominantly black, light yellow anteriorly; metasoma black, with metallic blue iridescence or completely black. Trochanters pale to light brown; fore femora pale to light orange, hind femora entirely black; fore tibia pale yellow to brownish, mid and hind tibiae entirely black; fore tarsus pale yellow, mid tarsus pale yellow with last 1–2 segments orangish to light brown, hind tarsus pale with all dark apices dark.

Male: Unknown.

Material. Holotype. ♀. Deposited at EMUS. 1. DHJPAR0036739 . 2. Caterpillar Voucher: D. H. Janzen & W. Hallwachs, DB: http://Janzen.sas.upenn.edu, Area de Conservation Guanacaste , Costa Rica, 09-SRNP-42662. Database information: Costa Rica, ACG, Alajuela Prov., Sector Rincon Rain Forest , Quebrada Escondida , 10.89928, -85.27486, 420m (Anabelle Cordoba), Piletosoma thialis ( Crambidae ) caterpillar feeding on Doliocarpus multiflorus ( Dilleniaceae ) coll. 22.ix.2009, wasp eclosed 19.x.2009. Paratypes. 2 ♀, ( EMUS, MNCR). COSTA RICA, ACG database codes: 02-SRNP-720715, DHJPAR0014016 (♀); 09-SRNP-42108, DHJPAR0036732 (♀).

Barcode. DNA barcode of female holotype DHJPAR0036739 (636 bp):

GGCCCTTTACTTTATTTTTGGCATTTGAGCTGGAATAATTGGAACCTCTCTAAGAATCATTATTCG AATAGAATTAGGAACCCCCGGCTCTTTAATTAATAATGACCAAATTTATAATTCTATCGTCACTATAC ATGCCTTTATCATAATTTTTTTTATAGTAATACCAATTATGATTGGGGGATTTGGTAATTGACTTGCTCCATT AATATTGGGGGCCCCAGATATAGCTTTCCCACGAATAAATAATATAAGATTTTGATTATTACCCCCATC ATTATTCTTATTAATTTCAGGAAGAATCCTAAATCAAGGGGCCGGAACTGGATGAACAGTATATCCACCTTTATC ATCTAATACTAATCATGAAGGATTATCAGTTGATTTAAGAATTTTTTCCCTTCATTTAGCAGGCATGTCCTCAATT ATAGGGGCAATCAACTTCATTACAACTATTTTTAATATAAAAATTAAATTATTAACTTTAGACCAACTTTCATT ATTTATTTGATCTATTAAAATTACTACTATTCTTCTACTACTTGCAGTCCCTGTTTTAGCAGGGGCAATCACT ATATTATTAACAGATCGTAACTTAAA TACCTCTTTTTTTGACCCAAGAGGGGGCGGAGACCC

Etymology: This species is named in honor of the late Sondra Ward, formerly of the Natural History Museum in London, for her invaluable assistance in the study of Ichneumonidae .

Comments. We were unable to distinguish L. sondrawardae morphologically from L. hugokonsi . Both species have metallic blue on the metasoma, the scape dark colored (at least dorsally) and without white on the apex, the tegula entirely or at least 90% black, hind tarsomeres 1–2 with dark apices, and hind tibia with white base not extending more than 3.0 × length of tibia. However, L. sondrawardae has a very distinctive and different DNA barcode, and it parasitizes a very different species of caterpillar feeding on a different family of host plants.

Hosts. Leurus sondrawardae has been reared from Piletosoma thialis Dyar ( Crambidae ) feeding on the rainforest liana, Doliocarpus multiflorus ( Dilleniaceae ). No other species of the L. caeruliventris complex in ACG utilizes this caterpillar genus or this host plant family.

Figures

FIGURES 10–13. Leurus spp. 10 L. jesusugaldei (DHJPAR0041070), mesoscutum, dorsal view. 11. L. sondrawardae (DHJPAR0036732) hind legs, lateral view. 12. L. henrytownesi. (DHJPAR0036798) hind legs, lateral view. 13. L. jesusugaldei (DHJPAR0041070) hind legs, lateral view.