Leurus pammitchellae Zuñiga & Valerio, 2024

Zuñiga, Ronald, Valerio, Alejandro A., Hanson, Paul, Smith, M. Alex, Hallwachs, Winnie & Janzen, Daniel H., 2024, Cryptic diversity of Leurus wasps (Hymenoptera: Ichneumonidae: Metopiinae), parasitoids of caterpillars in Area de Conservación Guanacaste, Costa Rica, Zootaxa 5529 (3), pp. 511-531 : 527-528

Leurus pammitchellae Zuñiga & Valerio , sp. nov.

( Fig. 9 )

Diagnostic description. Female. Fore wing length, 5.2−5.6 mm (holotype 5.2 mm). Malar space 0.8−1.1 × basal mandibular width; antenna with 23–24 flagellomeres, most flagellomeres quadrate, except for the first 2 and the last 2–3. Coloration. Antennal scape black with apex white, pedicel yellowish to light brown, flagellum brownish; tegula light yellow anteriorly, brown posteriorly; metasoma black, with metallic blue iridescence or black. Trochanters pale to light brown; fore and mid femora predominantly black, hind femora entirely black; fore tibia pale yellow to orangish, mid and hind tibiae predominantly black whit apex white; fore tarsus pale yellow, mid tarsus pale yellow with last 1–2 segments orangish to light brown, hind tarsus with first 2–3 segments mostly pale with dark apices, last 2–3 segments all dark.

Male: Unknown.

Material. Holotype. ♀. Deposited at EMUS. Specimen labels: 1. DHJPAR0039387 . 2. Caterpillar Voucher: D. H. Janzen & W. Hallwachs, DB: http://Janzen.sas.upenn.edu, Area de Conservation Guanacaste , Costa Rica, 10-SRNP-2437. Database information: Costa Rica, ACG, Alajuela Prov., Sector Rincon Rain Forest , Sendero Albergue Crater , 10.84886, -85.328, 980m (Osvaldo Espinoza), Microthyris prolongalis ( Crambidae ) caterpillar feeding on Ipomoea batatas ( Convolvulaceae ), coll. 16.v.2010, wasp eclosed 10.vi.2010 . Paratypes. 2 ♀, ( EMUS, MNCR). COSTA RICA, ACG database codes: 10-SRNP-2938: DHJPAR0036264 (♀); 10-SRNP-2422: DHJPAR0039539 (♀).

Barcode. DNA barcode of female holotype DHJPAR0039387 (286 bp):

TATATTTGGTGCATCAATTAGAATAATTATTCGTATAGAATTAGGAACCCCTAGTTCATTAATTAATAATGACC AAATTTATAACTCTATAGTTACTATACATGCTTTTATTATAATTTTTTTTATAGTGATACCAATTATAATTG GGGGATTCGGAAATTGACTTATTCCCTTAATATTAGGAGCCCCAGACATGGCCTTTCCACGATTAAATAATATAAG ATTTTGACTTTTACCCCCTTCATTATTTTTATTAATTTCAGGAAGCATTTTAAATCAAGGAGCT

Etymology: This species is named in honor of the late Pamela Mitchell, in recognition of her life of dedicated support of the study of Costa Rican Ichneumonidae by the Gauld and Mitchell team.

Comments. Leurus pammitchellae is distinctive not only for its morphology, but also for its very different barcode and its host specificity to a very common leaf roller of herbaceous convolvulaceous vines growing in full sun in the ACG rain forest.

Hosts. While the three rearing records from 505 wild-caught caterpillars of Microthyris prolongalis make it appear to be exceptionally rare, it may not be when the taxonomy of the moth is fully worked out; in ACG, “ M. prolongalis ” constitutes at least two different species of crambids feeding on seven species of Convolvulaceae , and we note that all three L. pammitchellae were only from the 346 rearings on Ipomoea batatas .

Figures

FIGURES5–9.Leurusspp.5.L.marojorietownesae(DHJPAR0037758)mesoscutum,dorsalview.6.L.wahli(DHJPAR0039547) mesoscutum,dorsalview.7.L.billeberhardi.(DHJPAR0039118),legs, dorso-lataeralview.8L.caeruliventris(DHJPAR0009640) mesoscutum, dorsal view. 9. L. pammitchellae (DHJPAR0039539) mesoscutum, dorsal view.