Leurus marjorietownesae Zuñiga & Valerio, 2024

Zuñiga, Ronald, Valerio, Alejandro A., Hanson, Paul, Smith, M. Alex, Hallwachs, Winnie & Janzen, Daniel H., 2024, Cryptic diversity of Leurus wasps (Hymenoptera: Ichneumonidae: Metopiinae), parasitoids of caterpillars in Area de Conservación Guanacaste, Costa Rica, Zootaxa 5529 (3), pp. 511-531 : 525-526

publication ID	https://doi.org/ 10.11646/zootaxa.5529.3.5
publication LSID	lsid:zoobank.org:pub:09787995-E3D5-4FB7-AB9F-AFB46371B02B
DOI	https://doi.org/10.5281/zenodo.14022823
persistent identifier	https://treatment.plazi.org/id/572E8790-0F11-A717-95FE-54711692FCDD
treatment provided by	Plazi
scientific name	Leurus marjorietownesae Zuñiga & Valerio
status	sp. nov.

Treatment

Leurus marjorietownesae Zuñiga & Valerio , sp. nov.

( Figs. 16 View FIGURES 14–19 , 22 View FIGURES 20–25 )

Diagnostic description. Female. Fore wing length 5.1–5.5 mm (holotype 5.2 mm). Malar space 0.8–1.1 × basal mandibular width; antenna with 26–27 flagellomeres, these being quadrate except for the first 2–3 and last 2–3. Genitalia: setae on ovipositor sheaths extending basally for a distance less than 0.3x the total length, more or less sparse throughout sheaths width, setae sparse, thin and elongated; lower-anterior extension of quadrate plate elongated and thin, somewhat lobate at tip, setae on ventral edge of quadrate plate thin, normally large. Coloration. Antennal scape and pedicel yellow; flagellum yellowish at base, brown at apex. Tegula whitish anteriorly, orange posteriorly. Metasoma black. Trochanters yellow; front femur yellow to orange, mid femur mostly black but yellow at apex, hind femur all black; front tibia yellow, mid and hind tibiae yellow at base, black at apex; front tarsus yellow with last segment orange, mid tarsus yellow with last 2 segments brown, hind tarsus with segments 1–3 yellow except light brown at apices, segments 4–5 light brown.

Male. Similar to female in size and color. Antenna with 26 flagellomeres. Genitalia: digitus 2/3 lobate at base, otherwise elongate, somewhat acute; volsella medial area deep, volsella tip (in lateral view) clearly flat; phallus apex somewhat stout, phallus constriction short; overall shape of phallus based on the width difference between the phallus apex and the phallus width: somewhat thin, straight in appearance; distal third of gonoforceps conspicuously setose.

Material. Holotype. ♀. Deposited at EMUS. Specimen labels: 1. DHJPAR0036816 . 2 Caterpillar Voucher: D. H. Janzen & W. Hallwachs, DB: http://Janzen.sas.upenn.edu, Area de Conservasion Guanacaste , Costa Rica, 09-SRNP-72684. Database information: Costa Rica, ACG, Prov., Guanacaste, Sector Pitilla , Estación Quica , 10.99697, -85.39666, 470m (Dinia Martinez) Ategumia matutinalis ( Crambidae ) caterpillar feeding on Miconia lacera ( Melastomataceae ) coll. 23.ix.2009, wasp eclosed 125. x.2009. GoogleMaps Paratypes. 20 ♀, 5 ♂, ( EMUS, MNCR, MZUCR, USNM). COSTA RICA, ACG database codes: 09-SRNP-40709: DHJPAR0035261 (♀); 09-SRNP-43588: DHJPAR003842 (♀); 02-SRNP-6303: DHJPAR0014020 (♀); 09-SRNP-69907: DHJPAR0037722 (♀); 10- SRNP-81107: DHJPAR0041095 (♂); 09-SRNP-69851: DHJPAR0037717 (♀); 10-SRNP-80312: DHJPAR0041281 (♀); 09-SRNP-69847: DHJPAR0037718 (♀); 09-SRNP-72785: DHJPAR0037788 (♀); 09-SRNP-80103: DHJPAR0037712 (♂); 09-SRNP-80261: DHJPAR0041284 (♀); 05-SRNP-6298: DHJPAR0028661 (♀); 07-SRNP-41144: DHJPAR0021655 (♀); 09-SRNP-73809: DHJPAR0038427 (♀); 05-SRNP-6297: DHJPAR0028652 (♀); 09- SRNP-32729: DHJPAR0037758 (♀); 08-SRNP-70147: DHJPAR0027735 (♂); 09-SRNP-69909: DHJPAR0037721 (♂); 09-SRNP-40709: DHJPAR0035261 (♀); 09-SRNP-69848: DHJPAR0037720 (♀); 11-SRNP-81170: DHJPAR0045775 (♀); 13-SRNP-75204: DHJPAR0050875 (♀); 13-SRNP-75114: DHJPAR0050878 (♀); 13- SRNP-70368: DHJPAR0052174 (♀); 12-SRNP-67267: DHJPAR0050376 (♀); 12-SRNP-69657: DHJPAR0048870 (♀); 13-SRNP-76776: DHJPAR0052751 (♀); 13-SRNP-75702, DHJPAR0051710 (♂).

Barcode. DNA barcode of female holotype DHJPAR0036816. (623bp):

TAATTGGTGCTTCTTTAAGTATTATTATTCGAATAGAACTAGGAACCCCCGGGTCTCTAATTAATAA TGATCAAATTTATAATTCTATTGTAACTATACATGCTTTTATTATAATTTTTTTTATAGTTATACCAATTATAA TTGGGGGATTTGGAAATTGACTCACCCCCTTAATATTAGGAGCCCCAGATATAGCTTTTCCTCGTATAA ATAATATAAGATTTTGATTATTACCTCCATCATTATTTTTATTAATTTCTGGAAGAATTTTAAATC AAGGGGCAGGAACTGGTTGAACAGTTTACCCTCCTTTATCATCTAATATTAACCATGAAGGACTATC AGTTGATTTAAGAATTTTTTCCCTTCATTTAGCGGGAATATCCTCAATTATAGGGGCAATTAATTTTATTACAACT ATTTTTAATATAAAAATTAAATTTTTAACCTTAGATCAACTTTCTTTATTTATTTGATCTATTAAAATTACT ACTATTTTACTTTTATTAGCAGTCCCTGTTTTGGCAGGAGCAATCACTATATTATTAACTGATCGTAACTTAA ATACTTCTTTTTTTGACCCAAGTGGGGGAGGTGACCCAATTTTATACCAACATTTATTT

Etymology. This species is named in honor of the late Marjorie Townes for her steadfast and high quality support of Henry Townes, and her role in the founding and development of the American Entomological Institute and its outstanding collection of Hymenoptera .

Comments. Leurus marjorietownesae , like L. iangauldi and L. pammmitchellae , has a black metasoma without metallic blue reflections. However, L. marjorietownesae differs by having the tegulae pale colored anteriorly and orange posteriorly (as opposed to dark brown posteriorly).

Hosts. This species, like L. henrytownesi , parasitizes caterpillars of Ategumia lotanalis ( Crambidae ) feeding on rain forest Melastomataceae foliage. Leurus henrytownesi parasitizes caterpillars on melastomes with small and insolated leaves, while L. marjorietownesae parasitizes caterpillars on melastomes with large and often shaded leaves. L. marjorietownesae has been reared 29 times from Ategumia lotanalis and A. matutinalis feeding on five spec i es of Melastomataceae .