Leurus iangauldi Zuñiga & Valerio, 2024

Zuñiga, Ronald, Valerio, Alejandro A., Hanson, Paul, Smith, M. Alex, Hallwachs, Winnie & Janzen, Daniel H., 2024, Cryptic diversity of Leurus wasps (Hymenoptera: Ichneumonidae: Metopiinae), parasitoids of caterpillars in Area de Conservación Guanacaste, Costa Rica, Zootaxa 5529 (3), pp. 511-531 : 523-524

publication ID

https://doi.org/ 10.11646/zootaxa.5529.3.5

publication LSID

lsid:zoobank.org:pub:09787995-E3D5-4FB7-AB9F-AFB46371B02B

DOI

https://doi.org/10.5281/zenodo.14034660

persistent identifier

https://treatment.plazi.org/id/572E8790-0F13-A715-95FE-543A1531FC65

treatment provided by

Plazi

scientific name

Leurus iangauldi Zuñiga & Valerio
status

sp. nov.

Leurus iangauldi Zuñiga & Valerio , sp. nov.

( Figs. 15 View FIGURES 14–19 , 21 View FIGURES 20–25 )

Diagnostic description. Female. Fore wing length, 5.2−5.6 mm (holotype 5.2 mm). Malar space 0.8−1.1 × basal mandibular width; antenna with 23–24 flagellomeres, most flagellomeres quadrate, except for the first 2 and the last 2–3. Genitalia: setae on ovipositor sheaths extending basally for a distance greater than 0.3x the total length, more or less sparse throughout sheath width; lower-anterior extension of quadrate plate short and broad, somewhat square at tip, setae on ventral edge of quadrate plate thin, normally large. Coloration. Antennal scape pale yellow to orangish, pedicel yellowish orange to light brown, flagellum dark brown; tegula light yellow anteriorly, brown posteriorly; metasoma black, without any metallic blue iridescence. Trochanters yellowish orange to light brown; fore and mid femora predominantly orange, hind femora predominantly black; fore tibia pale yellow to orangish, mid and hind tibiae pale yellow basally, black apically; fore tarsus pale yellow with last segment more orangish, mid tarsus pale yellow with last 1–2 segments orangish to light brown, hind tarsus with first 2–3 segments mostly pale with dark apices, last 2–3 segments all dark.

Male. Similar to female in size and color. Antenna with 22–23 flagellomeres. Genitalia: digitus completely lobate at base; volsella medial area shallow, volsella tip (in lateral view) mainly rounded but somewhat flat; phallus apex slender; overall shape of phallus based on the width difference between the phallus apex and the phallus width: somewhat broad, phallus width clearly narrower than apex width; distal third of gonoforceps normally setose, setae somewhat sparse.

Material. Holotype. ♀. Deposited at EMUS. Specimen labels: 1. DHJPAR0036020 . 2. Caterpillar Voucher: D. H. Janzen & W. Hallwachs, DB: http://Janzen.sas.upenn.edu, Area de Conservación Guanacaste , Costa Rica, 09-SRNP-69785. Database information: Costa Rica, ACG, Alajuela Prov., Sector Rincon Rain Forest , Cafecito , 10.94404, -85.31738, 455 m, (Noe Castillo) caterpillar feeding on Pourouma bicolor ( Urticaceae ), coll 11.viii.2009, wasp eclosed 27.viii.2009. GoogleMaps Paratypes. 13 ♀, 8 ♂, ( EMUS, MNCR, MZUCR, USNM). COSTA RICA, ACG database codes: 06-SRNP-41643: DHJPAR0028681 (♀); 06-SRNP-42818: DHJPAR0021540 (♀); 06-SRNP-42815: DHJPAR0021550 (♀); 06-SRNP-42822, DHJPAR0021529 (♀); 06-SRNP-42820:DHJPAR0021570 (♀); 06-SRNP-41638: DHJPAR0028690 (♀); 01-SRNP-4060: DHJPAR0014022 (♀); 01-SRNP-4772: DHJPAR0014013 (♀); 01- SRNP-4295: DHJPAR0028072 (♀); 10-SRNP-40127: DHJPAR0038463 (♂); 10-SRNP-40128, DHJPAR0039132 (♂); 10-SRNP-40125: DHJPAR0039137 (♂); 06-SRNP-42817, DHJPAR0021572 (♂); 01-SRNP-4112: DHJPAR0014024 (♀); 02-SRNP-7322, DHJPAR0014017 (♂); 06-SRNP-44060: DHJPAR0016996 (♀);10-SRNP-69022, DHJPAR0038789 (♂); 10-SRNP-69023: DHJPAR0038834 (♀); 06-SRNP-42813, DHJPAR0021559 (♂); 02- SRNP-7332: DHJPAR0014014 (♂); 00-SRNP-14124, DHJPAR0014023 (♀).13-SRNP-40334: DHJPAR0050743 (♀); 11-SRNP-81742: DHJPAR0046788 (♀); 06-SRNP-42816: DHJPAR00121189 (♀) .

Barcode. DNA barcode of female holotype DHJPAR0036020 (574 bp):

TGGATCTTTAATTAATAATGATCAAATTTATAATTCTATTGTAACTATACATGCCTTTATTATAATTTTCTTT ATAGTAATACCTATTATGATTGGTGGATTTGGAAATTGATTAACCCCCCTAATATTAGGGGCCCCAG ATATAGCTTTCCCCCGAATAAATAATATAAGATTTTGATTACTACCCCCCTCATTATTTTTATTAATTTCTG GGGGTATTTTAAATCAAGGGGCTGGGACTGGCTGAACAGTTTACCCCCCTTTATCATCCAATGTAA ATCATGAAGGATTATCAGTTGATCTAAGAATTTTCTCCCTTCATTTAGCTGGAATATCATCAATCATAGGGGCAATT AATTTCATTACAACCATTTTTAATATAAAAATTAAATTATTATCTTTAGAACAACTTTCTTTATTTATTTGATCT ATTAAAATTACCACTATTTTACTTTTACTAGCAGTCCCTGTTTTAGCAGGAGCAATTACTATATTATTAACAG ATCGCAATTTAAATACTTCTTTTTTTGACCCTAGTGGAGGAGGAGACCCAATTTTATACCAACACTTATTT

Etymology. This species is named in recognition of the late Ian Gauld for his massive contributions to our understanding of the Ichneumonidae of the world, the Hymenoptera of Costa Rica, and very specifically, the Ichneumonidae of ACG since 1989.

Comments. Leurus iangauldi is the only species in the L. caeruliventris complex having the mid femur orangish colored; L. sondrawardae is somewhat similar in this respect, but has the mid femur more brownish. Leurus iangauldi is similar to Leurus marjorietownesae in having the metasoma black, without any noticeable metallic reflections, but the tegula of the former is dark colored posteriorly (as opposed to orange). The color of the scape and the tegula of L. iangauldi is similar to that of L. caeruliventris , but the former differs by having a black metasoma without metallic reflections and by its orangish mid femur. It is also distinguished from all other species of ACG Leurus by its DNA barcode.

Hosts. Leurus . iangauldi has been reared 28 times from 4,300 caterpillars of the three species of ACG Patania ( Crambidae , Spilomelinae) that feed on the leaves of Pourouma , Cecropia , and Urera ( Urticaceae ) ( Table 1 View TABLE 1 ). It shares two of its host caterpillar species with L. caeruliventris , but the latter species has not yet been recorded from Patania Solis 01, a specialist on Pourouma .

MNCR

Museo Nacional de Costa Rica

USNM

Smithsonian Institution, National Museum of Natural History

Kingdom

Animalia

Phylum

Arthropoda

Class

Insecta

Order

Hymenoptera

Family

Ichneumonidae

Genus

Leurus

GBIF Dataset (for parent article) Darwin Core Archive (for parent article) View in SIBiLS Plain XML RDF