Leurus hugokonsi Zuñiga & Valerio, 2024

Zuñiga, Ronald, Valerio, Alejandro A., Hanson, Paul, Smith, M. Alex, Hallwachs, Winnie & Janzen, Daniel H., 2024, Cryptic diversity of Leurus wasps (Hymenoptera: Ichneumonidae: Metopiinae), parasitoids of caterpillars in Area de Conservación Guanacaste, Costa Rica, Zootaxa 5529 (3), pp. 511-531 : 522-523

Leurus hugokonsi Zuñiga & Valerio , sp. nov.

( Figs. 18 , 24 )

Diagnostic description. Female. Fore wing length 5.2–5.8 mm (holotype 5.4 mm). Malar space 1.1 × basal mandibular width; antenna with 23 flagellomeres, the latter transverse except the first 2–3 and the last 2–3. Genitalia: setae on ovipositor sheaths extending basally for a distance equal to or greater than 0.3 × total length, constrained to ventral edge, setae sparse, thin and elongated; lower-anterior extension of quadrate plate elongated and broad, lobate at tip, setae on ventral edge of quadrate plate thin, normally large. Coloration. Scape, pedicel, and flagellum predominantly black. Tegula entirely black, or with just anterior margin white. Metasoma with metallic blue and purple iridescence. Trochanters and femora mostly black, front femur with yellow at apex; front tibia yellow, mid and hind tibiae mostly black but yellow at base; fore tarsus pale yellow with last 3 segments more orangish, mid tarsus pale yellow with last 3 segments light brown, hind tarsus with first segment white except dark at extreme apex, remaining segments mostly all black.

Male. Similar to female in size and color, but with more white on anterior part of tegula (at least in some specimens); front femur orangish on anterior surface; hind tarsus with second segment mostly white, black at apex. Antenna with 23–26 flagellomeres.

Genitalia: digitus completely lobate at base; volsella medial area deep, volsella tip (in lateral view) mainly rounded but somewhat flat; phallus apex slender, phallus constriction short; overall shape of phallus based on the width difference between the phallus apex and the phallus width: somewhat broad, phallus width evidently narrower than apex width; distal third of gonoforceps normally setose, setae somewhat sparse.

Material. Holotype. ♀. Deposited at EMUS. Specimen labels: 1. DHJPAR0021094 . 2. Caterpillar Voucher: D.H.Janzen & W.Hallwachs, DB: http://janzen.sas.upenn.edu, Area de Conservación Guanacaste , COSTA RICA, 07-SRNP-2881. Database information: Costa Rica, ACG, Alajuela Prov., Sector San Cristobal, Sendero Vivero , 10.86739, -85.38744, 730m (Elda Araya) spiloBioLep01 BioLep577 ( Crambidae ) feeding on Maripa nicaraguensis ( Convolvulaceae ), coll. 22.vi.2007, wasp eclosed 19.vii.2007. Paratypes. 9 ♀, 1 ♂, ( EMUS, MNCR, MZUCR, USNM). COSTA RICA, ACG database: 09-SRNP-72625: DHJPAR0038422 (♂); 09-SRNP-73434: DHJPAR0037786 (♀); SRNP-73433: DHJPAR0038461 (♀); 11-SRNP-42694: DHJPAR0045047 (♀); 11-SRNP-42664: DHJPAR0045048 (♀); 11-SRNP-42697: DHJPAR0045046 (♀); 11-SRNP-42700: DHJPAR0045045 (♀); 11-SRNP-42951: DHJPAR0045041 (♀); 09-SRNP-73434: DHJPAR0037786 (♀); 11-SRNP-42705: DHJPAR0045044 (♀).

Barcode. DNA barcode of female holotype DHJPAR0021094 (657 bp):

ATTTTATACTTCATTTTTGGAATTTGAGCGGGTATAATTGGAGCATCTTTAAGTCTTATTATTCG AATAGAATTAGGAACCCCCGGGTCTTTGATTAATAATGATCAAATTTATAATTCTATTGTGACTATACATGCCTTT ATTATAATTTTCTTTATAGTAATACCAATTATAATTGGTGGATTTGGAAATTGACTTGTTCCTTTAATACTAGG AGCTCCAGATATAGCTTTCCCTCGTATAAATAATATAAGATTTTGGTTGTTACCCCCATCATTATTTTTATTAA TTTCTGGAAGTATCTTAAATCAAGGTGCTGGGACTGGTTGAACAGTATATCCTCCTCTATCATCTAATATTAATC ATGAAGGTTTATCAGTTGATTTAAGAATTTTTTCCCTCCATTTAGCTGGTATATCTTCAATTATAGGTGCAATT AATTTTATTACAACTATTTTTAATATAAAAATTAAATTATTAAATTTAGATCAACTTTCTTTATTTATCTGATCT ATTAAAATCACTACTATTTTACTTTTATTAGCTGCCCCTGTTTTAGCTGGAGCAATCACCATATTATTAACTG ATCGTAATTTAAATACTTCTTTCTTTGACCCTAGGGGAGGGGGGGACCCAATTTTATACCAACATTTATTT

Etymology. This species is dedicated to Hugo Kons formerly of the American Entomological Institute in recognition of his dedicated efforts to curate the Hymenoptera collection and aid in the resolution of Ichneumonidae taxonomic problems.

Comments. Morphologically, we were unable to distinguish L. hugokonsi from L. sondrawardae . Both have metallic blue on the metasoma, the scape dark colored (at least dorsally) and without white on the apex, the tegula entirely or at least 90% black, hind tarsomeres 1–2 with dark apices, and hind tibia with white base not extending more than 3 × length of tibia. However, L. hugokonsi can be distinguished by its distinctive barcode, and by its host caterpillar which it shares with no other species of Leurus .

Hosts. Leurus hugokonsi has been reared ten times from a sample of 211 caterpillars of spiloBioLep01 BioLep577 ( Crambidae , Spilomelinae) reared from two species of the rain forest vine Maripa ( Convolvulaceae ).

Figures

FIGURES 14–19. Leurus female genitalia in lateral view. 14 L. wahli (DHJPAR0028068). 15. L. iangauldi (DHJPAR0021570). 16. L. marjorietownesae (DHJPAR0041281). 17. L. caeruliventris (DHJPAR0021589). 18. L. hugokonsi (DHJPAR0038461). 19. L. henrytownesi (DHJPAR0028653).

FIGURES 20–25. Leurus male genitalia in dorsal view. 20 L. wahli (DHJPAR0028069). 21. L. iangauldi (DHJPAR0039132). 22. L. marjorietownesae (DHJPAR0037712). 23. L. caeruliventris (DHJPAR0037822). 24. L. hugokonsi (DHJPAR0038422). 25. L. henrytownesi (DHJPAR0028655).