Leurus henrytownesi Zuñiga & Valerio, 2024

Zuñiga, Ronald, Valerio, Alejandro A., Hanson, Paul, Smith, M. Alex, Hallwachs, Winnie & Janzen, Daniel H., 2024, Cryptic diversity of Leurus wasps (Hymenoptera: Ichneumonidae: Metopiinae), parasitoids of caterpillars in Area de Conservación Guanacaste, Costa Rica, Zootaxa 5529 (3), pp. 511-531 : 518-519

publication ID	https://doi.org/ 10.11646/zootaxa.5529.3.5
publication LSID	lsid:zoobank.org:pub:09787995-E3D5-4FB7-AB9F-AFB46371B02B
DOI	https://doi.org/10.5281/zenodo.14022819
persistent identifier	https://treatment.plazi.org/id/572E8790-0F18-A710-95FE-51A5153AF833
treatment provided by	Plazi
scientific name	Leurus henrytownesi Zuñiga & Valerio
status	sp. nov.

Treatment

Leurus henrytownesi Zuñiga & Valerio , sp. nov.

( Figs. 12 View FIGURES 10–13 , 19 View FIGURES 14–19 , 25 View FIGURES 20–25 )

Diagnostic description. Female. Fore wing length 5.5–5.9 mm (holotype 5.3 mm). Malar space 1.2–1.3 × basal mandibular width; antenna with 24–25 flagellomeres, these being mostly quadrate (slightly transverse in central flagellomeres) except first 1–2 and last 1–2, which are longer than wide. Genitalia: setae on ovipositor sheaths extending basally for a distance greater than 0.3x the total length, constrained to ventral edge, setae sparse, thin and elongated; lower-anterior extension of quadrate plate elongated and broad, lobate at tip, setae on ventral edge of quadrate plate conspicuously large, broad. Coloration. Antennal scape dark brown dorsally, yellow ventrally; pedicel dark brown; flagellum dark brown. Tegula light colored anteriorly, black posteriorly. Metasoma with metallic blue iridescence. Trochanters brown; femora black, fore femur with yellow at apex and some orange on anterior surface; fore tibia yellow, mid and hind tibiae black with yellow at extreme base; fore tarsus yellow with last segment orange, mid tarsus yellow with last 2 segments brown, hind tarsus entirely white without dark apices.

Male. Similar to female in size and color, but with scape, pedicel and base of flagellum yellowish orange; tegula orange posteriorly in some specimens; front and sometimes mid femur all orange, without any black. Antenna with 25–26 flagellomeres. Genitalia: volsella medial area deep, volsella tip (in lateral view) clearly flat; phallus apex somewhat stout, phallus constriction short; overall shape of phallus based on the width difference between the phallus apex and the phallus width: somewhat thin, straight looking; distal third of gonoforceps normally setose, setae somewhat sparse.

Material. Holotype. ♀. Deposited at EMUS. Specimen labels: 1. DHJPAR0030368 . 2. Caterpillar Voucher: D. H. Janzen & W. Hallwachs, DB: http://Janzen.sas.upenn.edu, Area de Conservation Guanacaste , Costa Rica, 09-SRNP-20115. Database information: Costa Rica, ACG, Guanacaste Prov., Sector Del Oro , Montecristo , 11.01373, -85.42531, 525m (Lucia Ríos) Ategumia lotanalis ( Crambidae ) caterpillar feeding on Miconia trinervia ( Melastomataceae ) coll. 08.i.2009, wasp eclosed 07.ii.2009 GoogleMaps . Paratypes 19 ♀, 5 ♂, ( EMUS, MNCR, MZUCR, USNM). COSTA RICA, ACG database codes: 05-SRNP-43402: DHJPAR0028653 (♀); 05-SRNP-43401: DHJPAR0028662 (♀); 09-SRNP-40871: DHJPAR0035145 (♀); 09-SRNP-40997: DHJPAR0035144 (♀); 09- SRNP-69902: DHJPAR0037719 (♀); 10-SRNP-81654: DHJPAR0041094 (♀); 05-SRNP-43396: DHJPAR0028654 (♀); 05-SRNP-42214: DHJPAR002865505 (♂); 05-SRNP-43403, DHJPAR0028664 (♀); 03-SRNP-10404: DHJPAR0028071 (♀); 09-SRNP-20818: DHJPAR0036798 (♀); 09-SRNP-80169: DHJPAR0037710 (♂); 11- SRNP-44169, DHJPAR0045717 (♀); 11-SRNP-81003, DHJPAR0045716 (♀); 09-SRNP-43156, DHJPAR0037810 (♀); 13-SRNP-69406, DHJPAR0051709 (♀); 09-SRNP-80158, DHJPAR0037711 (♀); 09-SRNP-80170, DHJPAR0037732 (♀); 12-SRNP-77300, DHJPAR0050887 (♀); 13-SRNP-2437, DHJPAR0069209 (♀); 12-SRNP-71337, DHJPAR0049680 (♀); 11-SRNP-69288, DHJPAR0042379 (♂); 12-SRNP-81899, DHJPAR0050852 (♂).

Barcode. DNA barcode of female holotype DHJPAR0030368 (603bp):

TATTCTATATTTTATTTTTGGAATTTGAGCTGGTATAATTGGGGCCTCTTTAAGTATTATTATTCG AATAGAACTAGGAACCCCCGGGNCTCTAATTAATAATGATCAAATTTACAATTCTATTGTAACTATACATGCTTTT ATTATAATTTTCTTTATAGTTATACCAATTATAATTGGGGGATTTGGAAATTGACTCACCCCTTTAATATTAGG AGCTCCAGATATAGCTTTCCCTCGTATAAATAATATAAGATTTTGATTATTACCTCCATCATTATTTTT ATTAATTTCTGGGAGAATTTTAAATCAAGGAGCAGGGACTGGTTGAACAGTTTACCCTCCTTTATCATCTAATATT AATCATGAAGGGATATCAGTTGATTTAAGAATTTTTTCCCTTCATTTAGCTGGTATATCCTCAATTATAGGAGC AATCAATTTTATTACAACTATTTTTAATATAAAAATTAAATTATTAACCTTAGACCAACTTTCTTTATTTATCTG ATCAATTAAAATTACTACTATTTTACTTTTACTAGCAGTCCCTGTTTTAGCAGGAGCAATCACTATATTATTAA CTGATCGTAATTTAAACAC

Etymology. This species is dedicated to the late Henry Townes, co-founder and funder of the American Entomological Institute, life-long researcher, pioneer in developing the systematics of the world Ichneumonidae , and identifier of the first ichneumonid reared by DHJ in ACG in 1978 ( Thyreodon atriventris DHJPAR 0000487), while the nascent institute resided in Ann Arbor, Michigan (now at EMUS).

Comments. Leurus henrytownesi can be distinguished by the combination of metallic blue metasoma, scape dark colored at least dorsally, tegula light anteriorly dark posteriorly, and male front femur without any black markings. It can also be distinguished by its distinctive barcode and by its hosts.

Hosts. This species has been reared 26 times from Ategumia lotanalis ( Crambidae ) feeding on four species of rain forest Melastomataceae ( Table 1 View TABLE 1 ), most frequently the common second growth shrub Conostegia xalapensis . This host crambid is the same as that of L. marjorietownesae , but the host plants are mostly different ( Table 1 View TABLE 1 ; see discussion of hosts under L. marjorietownesae ). Leurus henrytownesi has also been reared from Microthyris prologalis (Guenée) ( Crambidae ) feeding on sweet potato ( Convolvulaceae : Ipomoea batatas ), the same crambid and host plant utilized by L. pammitchelli .