Lehetua indrekii Tedersoo, 2024

Tedersoo, Leho, Magurno, Franco, Alkahtani, Saad & Mikryukov, Vladimir, 2024, Phylogenetic classification of arbuscular mycorrhizal fungi: new species and higher-ranking taxa in Glomeromycota and Mucoromycota (class Endogonomycetes), MycoKeys 107, pp. 249-271 : 249-271

Lehetua indrekii Tedersoo sp. nov.

Diagnosis.

Separation from other species of Lehetua based on the ITS region (positions 219–248 ttataatcttacgaagtactgaggtgatta; one mismatch allowed) and LSU (positions 515–546 aactaaaggratgtggctcctcggagtgttta; one mismatch allowed) as indicated in Fig. 9 .

Type.

Soil eDNA sample TUE 103095 (holotype); type sequence EUK 1603180 (lectotype); GSMc plot S 590, Populus tremula forest (soil sample TUE 003095 ) in Lehetu , Estonia, 59.01857 ° N, 24.28041 ° E .

Description.

Other sequences: EUK 1603180 (type locality); EUK 1602367 (LSU only; type locality; also found in 50 other sites in Estonia); EUK 1634481 (GSMc plot G 4195, Quercus robur woodland soil in Lustivere, Estonia, 58.66293 ° N, 26.08465 ° E); EUK 1603818 (GSMc plot G 5824, managed grassland soil in Kuremaa, Estonia, 58.74138 ° N, 26.52727 ° E); EUK 1603131 (GSMc plot G 4105, Picea abies forest soil in Lepa, Estonia, 57.70158 ° N, 26.23993 ° E); EUK 0021956 (GSMc plot G 5150, subarctic grassland soil in Kokelv, Norway, 70.61116 ° N, 24.62483 ° E); and EUK 0023592 (GSMc plot S 035, mixed deciduous forest soil in Kedrovaya Pad, Russia, 43.10834 ° N, 131.55447 ° E).

Etymology.

Lehetu (Estonian) refers to type locality (also meaning “ leafless ”); and Indrek (Estonian) refers to the first name of Indrek Hiiesalu who collected materials from the type locality.

Notes.

Found in Baltic States, Scandinavia and Russia, with ITS and LSU sequences differing up to 3.5 % and 0.2 %, respectively. Seems to be a generalist in terms of habitat type and soil pH; so far, not found from roots.

Figures

Figure 9. Diagnostic barcodes for Lehetua indrekii relative to closely-related taxa in ITS 2 and LSU.