Harpacticella jejuensis, Lee, Seunghan, Kim, Kichoon & Lee, Wonchoel, 2014

Lee, Seunghan, Kim, Kichoon & Lee, Wonchoel, 2014, A new species of Harpacticella Sars, 1908 (Copepoda, Harpacticoida), from a tidal pool on Jeju Island, Korea, ZooKeys 445, pp. 13-30 : 15-20

Taxon classification Animalia Harpacticoida Harpacticidae

Harpacticella jejuensis sp. n. Figs 1, 2, 3, 4, 5, 6

Type locality.

A tidal pool (33°13.949'N; 126°30.653'E) on Beophwan beach, Seoguipo-shi, Jeju Island, Korea.

Materials examined.

Holotype: 1♀ (NIBRIV0000304111) in 70% ethanol from the type locality. Paratypes: 5♀♀ (NIBRIV0000304112) in 70% ethanol, 2♀♀ (NIBRIV0000304113 - NIBR0000304114) dissected on 11 and 10 slides, respectively, and 2♂♂ (NIBRIV0000304115 - NIBR0000304116) dissected on 11 and 2 slides, respectively. All from the type locality and collected by R. Jeong on 3 March 2013.

DNA-barcode (mtCOI) sequence and trace were submitted to GenBank (KM272559, 619 bp).

Description.

Female. Total body length 720-810 µm (mean = 759 µm; n = 10, measured from anterior margin of cephalosome to posterior margin of caudal rami). Maximum width at posterior margin of cephalosome (mean = 380 µm; n = 10). Urosome gradually tapering posteriorly. Body surface armed with some sensilla (Figs 1 A–B).

Prosome (Fig. 1 A–B) 4-segmented, comprising cephalosome and 3 free pedigerous somites. P1-bearing somite fused to cephalosome. Cephalosome (Fig. 1A) with few sensilla and smooth posterior margin. Other prosomites with few sensilla on dorsal and lateral surfaces. Dorsal tegumental windows of elongated oval shape, one on cephalosome and one on three succeeding prosomites; 2 windows on genital double somite (Fig. 1A). Pleural areas well developed and rounded, without lobate posterolateral angles.

Rostrum (Fig. 1 A–C) well developed, trapezoid with smooth anterior apex, clearly defined at base. Dorsal surface smooth with pair of sensilla at apical margin.

Urosome (Figs 1 A–B, 2C) 5-segmented, comprising the P5 somite, genital double somite, 2 free abdominal somites, and anal somite. All urosomites with row of spinules ventrally. P5-bearing somite with smooth dorsal surface and row of spinules along lateral margins.

Genital double somite (Figs 1 A–B, 2C, 7A) subdivided by distinct chitinous structure laterally indicating original segmentation. Genital field located ventrally near anterior margin with copulatory pore positioned medially. P6 as small protuberance bearing 1 plumose seta.

Anal somite (Fig. 2C, D) without anal operculum, but with well-developed pseudoperculum arising from penultimate somite.

Caudal ramus (Figs 1 A–B, 2D) wider than long; seta I inserted at half length of caudal ramus, ventrolaterally; lateral seta II longer than seta I, inserted close to distal outer corner; seta III as long as lateral seta II; apical seta IV unipinnate, slightly longer than urosome; apical seta V bipinnate, as long as whole body; apical seta VI similar in length to seta III; dorsal seta VII bare and bi-articulate at its base.

Antennule 7-segmented (Fig. 2A). Aesthetascs on segments 4 and 7. All setae slender and bare. Armature formula: 1-[1], 2-[9], 3-[7], 4-[2 + (1+1 ae)], 5-[2], 6-[1], 7-[3+1 acrothek]. Apical acrothek consisting of well-developed aesthetasc fused basally to two slender naked setae.

Antenna (Fig. 2B) 3-segmented, comprising coxa, allobasis, 1-segmented endopod, and 2-segmented exopod. Coxa small, bare. Allobasis elongated with two spinules on surface. First exp segment with bare seta on distal end; second segment 3 bare setae. Endopod with 2 spinules near proximal area, pinnate spine on dorsal surface, naked spine laterally; apically bare spine; 4 geniculate spiniform setae and bare spiniform seta, apically.

Mandible (Fig. 3A) with large coxa and well-developed gnathobase; cutting edge with 10 blunt teeth overlapping each other; accessory plumose seta at dorsal corner. Mandibular palp well developed. Basis with naked seta on lateral distal margin. Endopod 2-segmented; enp-1 with 2 juxtaposed setae at the middle of inner margin; enp-2 with 4 juxtaposed setae on distal end. Exopod 2-segmented; exp-1 with naked seta at the middle of inner margin; exp-2 with 4 juxtaposed setae on distal end.

Maxillule (Fig. 3B) with praecoxa arthrite with spinular row near proximal area; 2 spines on anterior and 1 on posterior surface subterminally; 2 unipinnate spines and 1 bare spine apically, 2 unipinnate spines and bare spine on lateral margin. Coxa with endite bearing 3 naked setae apically. Basis endite with row of spinules laterally; 3 spines and 3 bare setae apically. Endopod small and 1-segmented with 3 bare setae. Exopod elongated, with spinules and 3 setae apically.

Maxilla (Fig. 3C): syncoxa with 3 endites: proximal endite with 1 plumose seta apically; medial and distal endite each with 2 pinnate spines; basis with unipinnated claw: accessory armature consisting of 2 pinnated setae and bare seta. Endopod represented by small protuberance with 3 bare setae.

Maxilliped (Fig. 3D): syncoxa with bare seta and oblique row of spinules. Basis with spinule on inner margin and 3 spinules on outer margin. Endopod 1-segmented, forming strong spine with seta.

Swimming legs 1-4 (Figs 4 A–B, 5 A–B) biramous, P1-P4 with 3-segmented exopod and 3-segmented endopod; spinules along inner and outer margins as illustrated. Intercoxal sclerites well developed.

P1 (Fig. 4A): coxa with row of spinules along outer lateral margin. Basis shorter than wide, with strong outer seta; inner spine inserted near inner distal corner, with several spinules. Endopod shorter than exopod reaching about half of exp-2; end-1 with plumose seta at the middle of the inner margin; enp-2 small without ornamentation but a row of spinules along outer lateral margin; enp-3 longer than wide with pinnate claw distally and inner naked seta on distal inner margin. Exp-1 as long as exp-2, with spinules along outer margin and spine on distal outer corner; exp-2 with short naked seta on distal part of inner margin and pinnate spine at middle part of the outer margin; exp-3 short with 4 curved pinnate claws and bare seta.

P 2 (Fig. 4B): coxa with 2 rows of spinules along outer lateral margin. Basis shorter than wide, with slender outer seta and spinules on outer lateral margin. Endopod as long as exopod; row of spinules along outer margin of each segment. Exopodal segments with row of spinules along outer margin; exp-1 with 2 rows of spinules and pore on anterior surface; exp-2 with pore on anterior surface.

P3 (Fig. 5A): coxa with 2 rows of spinules along outer lateral margin. Basis shorter than wide, with slender outer seta and spinules along outer lateral margin. Endopod reaching to middle of exp-3; row of spinules along outer margin of each segment. Exopodal segments with row of spinules along outer margin; exp-1 with 2 rows of spinules and pore on anterior surface; exp-2 with pore on anterior surface.

P4 (Fig. 5B): coxa with 2 rows of spinules along outer lateral margin. Basis shorter than wide, with slender outer seta and spinules on outer lateral margin. Endopod shorter than exopod, reaching to proximal half of exp-3; row of spinules along outer margin of each segment. Exopodal segments with row of spinules along outer margin; exp-1 with 2 rows of spinules and pore on anterior surface; exp-2 with pore on anterior surface.

Armature formulae as follows:

P 5 (Fig. 3E): exopod and baseoendopod well separated. Baseoendopod with slender and bare outer lateral seta. Endopodal lobe larger than exopod and extended beyond distal margin of exopod; with 3 pinnate and 2 bare setae. Exopod oval, with 6 setae; rows of spinules along inner and outer margins.

Male. Total body length of examined samples 631-650 µm (mean = 643 µm; n = 5, measured from anterior margin of cephalosome to posterior margin of caudal rami). Greatest width at posterior margin of cephalosome. Cephalosome with sensilla along lateral margin. Other prosomites also with sensilla along lateral margin (Fig. 6A).

Prosome (Fig. 6A), 4-segmented, comprising cephalosome bearing first pedigerous somite and 3 free pedigerous somites. Cephalosome slightly narrower than in female, with smooth posterior margin. Prosomites 3 and 4 with some spinules along lateral proximal margin. Dorsal tegumental window elongated oval shape on cephalosome, three succeeding prosomites, and two genital somites (Fig. 6A). Rostrum well developed with pair of sensilla.

Urosome (Figs 6A, C, 7E) 6-segmented, with P5-bearing somite, genital somite, and 4 free abdominal somites. Free abdominal somites with rows of spinules ventrally. Caudal setae as in female. Sexual dimorphism in A1, P5, P6, and genital field.

Antennule (Fig. 6B) 6-segmented, chirocerate; geniculation between segment 5 and 6, segment 5 swollen and largest. Aesthetasc on segments 5 and 6. All setae slender and bare. Armature formula: 1-[1], 2-[1], 3-[8], 4-[9], 5-[7+(1+ae)], 6-[2+acrothek]. Apical acrothek with aesthetasc and 2 bare setae.

P5 (Figs 6C, D, 7D), baseoendopod fused medially, forming large transverse fig; each of them with slender and bare outer lateral seta. Exopod quadrangular, with 4 bare setae: inner, 2 terminal, outer bare setae.

P 6 (Fig. 6C, E): small fig with 3 bare setae; inner seta longest, outer seta shortest; row of spinules near base of setae.

DNA barcode.

mitochondrial oxidase subunit I; partial cds; 619 bp

ACTTTATATCTTTTAAGGGGGATATGAGCGGGAGTTATGGGGGCGGCAATAAGAGTTATTATTCGGCTTGAATTAGGACAGCCTGGGACTTTAATTAAGGATGAGCAAATTTATAATGTTTTAGTGACTTCGCATGCTTTTATTATAATTTTCTTTATGGTTATACCAATTTTAATTGGGGGGTTTGGAAACTGGTTAGTTCCTTTAATATTAGGAGCTCCTGATATGGCCTTTCCTCGATTAAATAATTTGAGATTCT GATTTTTGATGCCCTCTCTTATATTAATAATTATTAGAAGAGTTGTTGAAGGCGGGGCAGGGACAGGGTGAACTGTTTACCCCCCTTTAAGAAGAAATTTAGCACATGCAGGAGGCTCGGTGGATTTAGTAATTTTTTCTTTACATTTAGCAGGAGTTTCTTCCTTATTAGGGGCTGTAAATTTTATTAGGACTTTAAGAAATCTTCGAGTATTCGGGATGTATTTTGACCAAGTGCCGTTATTTTGTTGATCTGTCTTGGTTACAGCTGTTCTATTACTTTTATCACTGCCTGTATTAGCGGGGGCAATTACTATATTGTTGACCGATCGAAACATTAATTCAAGCTTCTATGATGTTA

Etymology.

The specific name refers to the type locality of Jeju Island, Korea.