Edaphochytrium valuojaense Tedersoo, 2025

Tedersoo, Leho, Hosseyni Moghadam, Mahdieh S., Panksep, Kristel, Prins, Victoria, Anslan, Sten, Mikryukov, Vladimir, Bahram, Mohammad, Abarenkov, Kessy, Kõljalg, Urmas, Esmaeilzadeh-Salestani, Keyvan, Pawłowska, Julia, Wurzbacher, Christian, Ding, Yi, Alkahtani, Saad Hussin & Nilsson, R. Henrik, 2025, Thirty novel fungal lineages: formal description based on environmental samples and DNA, MycoKeys 124, pp. 1-121 : 1-121

Edaphochytrium valuojaense Tedersoo sp. nov.

Diagnosis.

Separation from other species of Edaphochytrium based on ITS 2 (positions 99–118 tttctataatatttttgaca; one mismatch allowed) and LSU (positions 614–633 tgagatatttctgatttttg; one mismatch allowed) as indicated in Fig. 9 . Intraspecific variation up to 2.1 % in ITS 2 and up to 0.6 % in LSU. Interspecific distance at least 11.8 % in ITS 2 and 6.9 % in LSU.

Type.

Vouchered soil sample TUE 001432 ( holotype); eDNA sequence EUK 1123748 = OZ 253789 ( legitype); eDNA sample TUE 101432 ( nucleotype); GSMc plot G 4257 z, Salix fragilis grove soil in Valuoja park , Viljandi, Estonia, 58.3643°N, 25.5859°E .

Description.

Other sequences: EUK 0133766 ( GSMc plot G 3522, temperate deciduous forest soil in Pidula, Estonia, 58.4211°N, 22.1522°E); EUK 0474798 ( Populus × wettsteinii plantation soil in Nõgiaru, Estonia, 58.3262°N, 26.5545°E); and OU 941982 (grassland soil in Kungsängen, Sweden, 59.837°N, 17.661°E).

Etymology.

Edaphos (Greek) refers to ground, and Valuoja (Estonian) refers to the type locality.

Notes.

Found in soil across contrasting habitats in Estonia and Sweden (n = 4 records). GlobalFungi reveals an additional 35 records in European soils and two records in US soils, nearly all in cropland and grassland habitats.

Figures

Figure 9. Diagnostic nucleotide sequences of Edaphochytrium valuojaense relative to the closest related species in ITS 2 and LSU. Numbers indicate positions in the legitype (marked with an asterisk).