Chlosyne pardelina, Zhang & Cong & Shen & Song & Grishin, 2023

Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina & Grishin, Nick V., 2023, Genomic analysis reveals new species and subspecies of butterflies, The Taxonomic Report of the International Lepidoptera Survey 11 (6), pp. 1-63 : 9-11

Chlosyne pardelina Grishin, new species

http://zoobank.org/ 4BB18B88-5D31-42AF-B99C-5B7D74DDCD1F

( Figs. 6 part, 7)

Definition and diagnosis. Genomic sequencing of specimens identified as Chlosyne endeis (Godman & Salvin, 1894) (type locality in Mexico: Nayarit) reveals that they are either not monophyletic (in nuclear trees) or prominently separated into two clades (in the mitochondrial genome) ( Fig. 6). Fst /COI barcode difference between the specimens in two clades are 0.38/1.5% (10 bp), typical for closely related but distinct species of Chlosyne Butler, 1870 . Therefore, the specimens we sequenced belong to one of the two distinct species. We identify specimens from Nayarit, Mexico, the state with the type locality of C. endeis as that species. Specimens from south Texas ( USA) and eastern Mexico are not C. endeis and belong to a different species. This species was at times regarded as a subspecies of C. endeis under the name “pardelina ,” which was attributed either to Higgins (Lamas 2004) or to Scott (Pelham 2008). However, neither Higgins (1960) nor Scott (1986) made the name available. Higgins proposed “form pardelina forma nov. ” for “male specimens of endeis …, in which the ground-colour is yellow” ( Higgins 1960). However, according to Articles 45.6.1 and 45.6.4.1 of the ICZN Code (ICZN [International Commission on Zoological Nomenclature] 1999), this name is infrasubspecific because it was applied to an infrasubspecific entity and not “adopted” before 1985, and therefore is unavailable. The glossary of the ICZN Code defines “infrasubspecific entity” as “… Specimen(s) within a species differing from other specimens in consequence of intrapopulation variability (e.g., opposite sexes, …,” and Higgins applied the name to male specimens. Scott did not establish this name either because he merely applied it (not even referencing Higgins) to the subspecies of C. endeis “in the U.S. ” without description, definition, or bibliographic reference to such (fails Art. 13.1). Therefore, this species lacks an available name, and is new. This new species is generally similar to C. endeis in having brown wings with yellow or white spots, some in discal bands separated by veins, and two patches of submarginal red spots (sometimes vestigial) distad of the yellow discal band on the dorsal hindwing, by the apex and tornus. The new species differs from C. endeis in having a yellow to orange rather than a white discal band of dorsal hindwing (and frequently on forewing) and typically larger patches of red hindwing spots. Due to phenotypic variability, definitive identification is provided by DNA, and a combination of the following characters is diagnostic in the nuclear genome: hm2012952-RA.1:A156G, hm2012952-RA.1:A543T, hm2010701-RA.4:C66T, hm2018077-RA.9:G69C, hm2006719-RA.4:C78T and in COI barcode: A286C, C451T, 562T, 574C, A625G. Barcode sequence of the holotype. Sample NVG-17117C06, GenBank OR837724, 658 base pairs: TACTTTATATTTTATTTTTGGAATTTGAGCAGGAATAGTAGGAACATCTTTAAGACTTTTAATTCGAACAGAATTAGGAAATCCAGGTTCATTAATTGGAGATGATCAAATTTATAATACA ATTGTAACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGTAATTGATTAGTCCCATTAATATTAGGAGCTCCTGATATAGCTTTCCCACGAA TAAATAATATAAGATTTTGATTATTACCCCCCTCATTAATTCTCTTAATTTCCAGAAGAATTGTAGAAAATGGAGCAGGAACAGGATGAACAGTGTACCCCCCACTTTCATCTAATATTGC TCATAGAGGATCTTCTGTTGATTTAGCAATTTTTTCATTACATCTAGCTGGAATTTCATCAATTTTAGGAGCAATTAATTTTATTACTACAATCATTAATATACGAATTAATAATATATCA TTTGATCAAATACCTTTATTTGTTTGAGCAGTAGGTATTACAGCCCTTTTACTACTTTTATCTTTACCTGTATTAGCTGGAGCTATTACCATACTTCTAACTGATCGAAATATTAATACAT CATTTTTTGATCCTGCAGGGGGAGGAGATCCAATCTTATACCAACATTTATTT

Type material. Holotype: ♂ deposited in the Texas A&M University Insect Collection, College Station, TX, USA [ TAMU], illustrated in Fig. 7, bears six labels: five white [ TEXAS: | DUVAL COUNTY | Texas Hwy 16 ca | 15 mi ( 24 km) S | of Freer at Parrilla Creek], [ex larva | (had larval diapause) | 11 Sep 1980 | Roy O. Kendall | and C. A. Kendall], [Larval foodplant: | ACANTHACEAE | Carlowrightia | parviflora (Buckl. | Wasshausen (foliage)], [ NYMPHALIDAE : | Chlosyne endeis | pardelina | ♂ Higgins, 1960 | det. Roy O. Kendall | [M. & B. No. 601.b]], [DNA sample ID: | NVG-17117C06 | c/o Nick V. Grishin ], and one red [ HOLOTYPE ♂ | Chlosyne pardelina | Grishin ]. Its pupal case and the last instar caterpillar exuvium are in a gelatine capsule pinned under the specimen. The date given on the label refers to eclosion. Paratypes: 2♀♀: 1♀ the same data as the holotype, but eclosed on 13-Sep-1980 (NVG-17117C05) and 1♀ Mexico: San Luis Potosí, Rte 80, 2–7 mi NW Ciudad del Maíz, 16-Jul-1988, D. Mullins leg. (NVG-19086A10, USNMENT 01314130) [ USNM].

Type locality. USA: Texas, Duval Co., SH 16 ca. 15 mi south of Freer at Parrilla Creek , GPS 27.6478, −98.6572 .

pardelina refers to any small, spotted, or mottled bird, and it fits the general appearance of this species. The name is a feminine noun in apposition.

Distribution. South Texas and northeastern Mexico.