Borikenia urbinana Tedersoo, 2025

Tedersoo, Leho, Hosseyni Moghadam, Mahdieh S., Panksep, Kristel, Prins, Victoria, Anslan, Sten, Mikryukov, Vladimir, Bahram, Mohammad, Abarenkov, Kessy, Kõljalg, Urmas, Esmaeilzadeh-Salestani, Keyvan, Pawłowska, Julia, Wurzbacher, Christian, Ding, Yi, Alkahtani, Saad Hussin & Nilsson, R. Henrik, 2025, Thirty novel fungal lineages: formal description based on environmental samples and DNA, MycoKeys 124, pp. 1-121 : 1-121

Borikenia urbinana Tedersoo sp. nov.

Diagnosis.

Separation from other species of Borikenia based on ITS 2 (positions 56–75 acgttgtgtacacacacgtg; one mismatch allowed) and LSU (positions 170–189 ctgatcttggttgttgggta; one mismatch allowed) as indicated in Fig. 52 . Intraspecific variation up to 2.3 % in ITS 2 and up to 0.4 % in LSU. Interspecific distance at least 6.1 % in ITS 2.

Type.

Vouchered soil sample TUE 002010 ( holotype); eDNA sequence EUK 1189254 = OZ 253812 ( legitype); eDNA sample TUE 102010 ( nucleotype); GSMc plot G 5033, tropical rainforest soil in Luquillo, Puerto Rico, 18.3146, –65.747 .

Description.

Other sequences: EUK 1102667 (tropical rainforest soil in El Yunque, Puerto Rico, 18.29, – 65.78); EUK 0330861 ( GSMc plot AV 207, tropical rainforest soil in Puerto Santander, Colombia, – 0.6161, –72.401); EUK 0330863 ( GSMc plot S 1227, Eucalyptus plantation soil in Ayapel, Colombia, 8.27, – 75.2); EUK 0330864 ( GSMc plot S 1026, tropical rainforest soil in Matouta, Reunion, France, – 21.3522°N, 55.7059°E); EUK 0330862 ( GSMc plot S 003, Uapaca tropical forest soil in Manangotry, Madagascar, –24.745, 46.852); EUK 0330869 ( GSMc plot S 048, tropical rainforest soil in El Yunque, Puerto Rico, 18.3167, – 65.8167°E); EUK 0330870 ( GSMc plot JYK 035, Eucalyptus plantation soil in Rivercess, Liberia, 5.7282, –9.629); and EUK 0330871 ( GSMc plot S 1267, tropical rainforest soil in Khong Ngam, Thailand, 20.2433°N, 100.0981°E).

Etymology.

> Boriken (Taino) refers to Puerto Rico, where the type material originates, and Urbina (Spanish) refers to Hector Urbina, who was the first to collect material from this species ( EUK 1102667 ).

Notes.

Found in tropical grassland and forest soils in America, Africa, and Asia (11 localities). GlobalFungi reveals an additional record from subtropical forest soil in China.

Figures

Figure 52. Diagnostic nucleotide sequences of Borikenia urbinae relative to the closest related species in ITS 2 and LSU. Numbers indicate positions in the legitype (marked with an asterisk).