Antigonus ruptifasciata Plötz, 1884 Timochares Godman & Salvin, 1896 Leucochitonea trifasciata Hewitson, 1868 A. ruptifasciata Timochares trifasciata (Hewitson, 1868) A. ruptifasciata ruptifasciata A. ruptifasciata A. ruptifasciata A. ruptifasciata New taxa of butterflies supported by genomic analysis Zhang, Jing Cong, Qian Shen, Jinhui Song, Leina Grishin, Nick V. The Taxonomic Report of the International Lepidoptera Survey 2024 2024-11-04 12 3 1 63 95WVH Plotz, 1884 Plotz 1884 [750,1298,1534,1567] Insecta Hesperiidae Antigonus Animalia Lepidoptera 37 37 Arthropoda species ruptifasciata    Antigonus ruptifasciata Plötz, 1884was described from an unstated number of specimens from “South America” ( Plötz 1884) and is currently treated as a valid species of the genus  TimocharesGodman & Salvin, 1896(type species  Leucochitonea trifasciataHewitson, 1868) (Mielke 2005). In Latin, ruptusmeans broken, torn, or severed, and fasciameans band or stripe. The original description and the name indicate that  A. ruptifasciatahas bands broken into spots in contrast to  Timochares trifasciata(Hewitson, 1868)(type locality in Bolivia, as indicated on the label of the lectotype). To our knowledge, this species has not been recorded from South America (Evans 1953), and therefore the type locality is questionable. To deduce its possible type locality by genomic comparison, we searched for syntypesof  A. ruptifasciata. One syntype, from the Weymer collection, now in MFNB, was found ( Fig. 41a). According to its labels, it was identified by Plötz as  ruptifasciatabefore publication of the name (the name was given as “i l” for “in litteris”), and one of the identification labels is in Plötz’s handwriting. The specimen lacks any indication of its provenance, which may explain a vague “South America” as the type locality, possibly Plötz’s or Weymer’s guess. Although this specimen does not bear a label to explicitly indicate that it is a type specimen, it agrees with the original description and was studied and identified by Plötz before publication, and, therefore, it is a syntype. Moreover, the syntypealso agrees with the illustration of  A. ruptifasciatain Draudt (1923), which shows a pale specimen with large and distinct brown spots arranged into irregular bands (reproduced here as Fig. 41b). This illustration is a likely copy of Plötz’s unpublished and presumably lost drawing t.[afel] 1019 ( Plötz 1884). We have not found any other credible syntypesof  A. ruptifasciataand it is possible that no others existed. Nevertheless, we follow the ICZN Code Recommendation 73F (ICZN 1999) avoiding the assumption of the holotypeand considering any type specimens of  A. ruptifasciatato be syntypes.  To stabilize nomenclature and define the name  A. ruptifasciataobjectively, N.V.G. hereby designates the sequenced syntype, a female in the MFNB collection that bears the following seven white rectangular labels (1 stand last printed, others handwritten): [Coll. Weymer], [Ruptofasciata Plötz | no43 best. v. Plötz], [Trifasc.Hew.ist die | binden im Hfl mehr gerade], [ Antigonus(682-83.) | Ruptofasciata Pl.], [Ruptifasciata | Plötz i l], [56:2.], and [DNA sample ID: | NVG-21115G04 | c/o Nick V. Grishin] as the  lectotypeof  Antigonus ruptifasciata Plötz, 1884. The number 43 possibly refers to some specimen number in Weymer’s collection, maybe a sequential number of each specimen identified by Plötz in all Plötz’s identifications of Weymer’s specimens, like “43 rdspecimen identified by Plötz”; best[immt]. v[on]. is for identified by; the 2 ndand 5 thlabels are in Weymer's handwriting, and the 4 thlabel is in Plötz’s handwriting; the label 56:2 gives a genus number (56 -  Timochares) and a species number (2 - ruptifasciatus) in the Mabille catalog (1903) that was used as a guide for arranging the Hesperiidaenear the apex, right forewing in the middle, and right hindwing near the tornus. The COI barcode sequence of the lectotype, sample NVG-21115G04, GenBank PQ489711, 658 base pairs is: AACTTTATATTTTATTTTTGGAATTTGAGCAGGAATAGTTGGAACTTCTCTAAGCCTTCTTATTCGAACTGAATTAGGAAATCCCGGATCATTAATTGGAGATGATCAAATTTATAATACA ATTGTTACAGCTCATGCCTTCATTATAATTTTTTTTATGGTTATACCAATTATAATTGGAGGATTTGGAAATTGATTAGTACCATTAATATTAGGAGCTCCAGATATAGCATTTCCACGAA TAAATAATATAAGATTTTGACTTTTACCCCCCTCTTTAATATTATTAATTTCTAGAAGAATCGTAGAAAATGGAGCCGGAACAGGATGAACAGTTTACCCCCCCCTCTCAGCTAATATTGC ACACCAAGGTTCTTCTGTGGACTTAGCTATTTTTTCCCTACATTTAGCAGGTATCTCCTCAATTCTTGGAGCAATTAATTTTATTACAACAATTATTAATATACGAATTAGAAATTTATCC TTTGATCAAATACCCCTATTTGTCTGAGCTGTTGGTATTACAGCATTACTTTTATTATTATCTTTACCAGTTTTAGCTGGAGCTATTACTATACTTCTAACTGATCGAAATCTTAATACAT CATTTTTTGATCCTGCAGGAGGGGGAGATCCAATTTTATATCAACATTTATTT  Genomic comparison places the lectotypewith specimens from Jamaica and not with those from continental America ( Fig. 40). Wing patterns ( Fig. 41) agree with this conclusion: brown spots are larger and darker and stand out with more contrast from the pale ground color in the lectotype, more similar to Jamaicanspecimens. Therefore, the type locality of  A. ruptifasciatabecomes Jamaica. [230,1172,355,383] Jamaica Jamaica 39 39 1 lectotype Jamaica Jamaican Therefore 39 39 1 lectotype