Advancing butterfly systematics through genomic analysis Zhang, Jing Cong, Qian Shen, Jinhui Song, Leina Grishin, Nick V. The Taxonomic Report of the International Lepidoptera Survey 2025 2025-05-27 12 5 1 201 Grishin Grishin 2025 [544,889,1032,1065] Insecta Hesperiidae Vacerra Animalia Lepidoptera 169 169 Arthropoda species tama  http://zoobank.org/ 4774ED12-2163-4DB9-B8ED-DE65D9247593 ( Figs. 134part, 135–136)   Definition and diagnosis.The nuclear genomic tree of  VacerraGodman, 1900( typespecies  Hesperia litanaHewitson, 1866) reveals that a specimen from Mexico: Tamaulipas(NVG-22056G03) is a distant sister of  Vacerra gayra(Dyar, 1918)( typelocality in Mexico: Guerrero) and is strongly differentiated from it genetically ( Fig. 134); e.g., their COI barcodes differ by 4.7% (31 bp). Therefore, this specimen represents a new species. This new species is phenotypically similar to  V. gayraand keys to “  Vacerra egla gayra” (O.8.2.(a)) in Evans (1955) but differs from it by a more aligned basal margin of a paler marginal band on the ventral hindwing in cells Sc+R 1-RS and RS-M 1, so that the brown ground color basad of the band does not protrude more strongly in the cell RS-M 1than in the cell Sc+R 1-RS. In  V. gayra, the basal margin is stepwise in cells RS-M 1and Sc+R 1-RS, so that the brown ground color reaches closer to the wing outer margin in cell RS-M 1than in cell Sc+R 1-RS. Due to unexplored individual variation and possibly cryptic nature of this species, most reliable identification is achieved by DNA, and a combination of the following base pairs is diagnostic in the nuclear genome: aly412.8.5:A210G, aly9588.18.2:G48A, aly 2275.10.11:C135T, aly 2275.10.11:A159C, aly16031.3.3:T46C, aly16031.3.3:G48G (not A), aly318.28.9:T294T (not C), aly318.28.9:G300G (not C), aly925.11.9:C336C (not T), aly925.11.9: T342T (not C); and COI barcode: T46A, A49C, T64C, A199G, T439C, T514C. Barcode sequence of the holotype. Sample NVG-22056G03, GenBank PV550059, 658 base pairs: AACTTTATATTTTATTTTTGGTATTTGAGCAGGAATACTAGGAACATCCCTAAGACTATTAATCCGTACAGAATTAGGTAATCCAGGATCTTTAATTGGAGATGATCAAATTTATAATACT ATTGTTACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCAATTATAATTGGAGGATTTGGAAATTGATTGGTTCCTCTTATATTAGGAGCTCCAGATATAGCTTTTCCACGAA TAAATAATATAAGATTTTGAATATTACCCCCCTCATTAACTTTATTAATTTCAAGAAGAATTGTTGAAAATGGTGCAGGAACTGGTTGAACTGTATATCCACCTTTATCTTCAAATATTGC CCATCAAGGAGCTTCAGTTGATTTAGCAATTTTTTCTCTTCATTTAGCAGGTATTTCTTCTATTCTAGGAGCTATCAACTTTATTACAACAATTATTAATATACGAATTAAAAATTTATCT TTTGATAAAATACCTTTATTTGTTTGATCCGTGGGTATTACAGCCTTATTATTACTTTTATCTTTACCTGTTTTAGCTGGAGCTATTACTATATTACTTACTGATCGAAATTTAAATACTT CATTTTTTGATCCAGCAGGAGGAGGAGATCCAATTTTATATCAACATTTATTT   Type material.   Holotype: ♂deposited in the collection of the Biodiversity Center, University of Texas at Austin, Austin, TX, USA ( TMMC), illustrated in Fig. 135(genitalia Fig. 136), bears the following five printed rectangular labels, four white: [TA.GomezFarias.017 | 1–3kSSW ElAzteca | DurdenCJ 91145A36], [DNA sample ID: | NVG-22056G03 | c/o Nick V. Grishin], [DNA sample ID: | NVG-24015E06 | c/o Nick V. Grishin], [genitalia: | NVG241114-12 | c/o Nick V. Grishin], and one red [HOLOTYPE ♂ | Vacerra tama| Grishin]. The first DNA sample (sequenced) refers to the extraction from a leg and the second (stored) is from the abdomen prior to genitalia dissection. The holotype was collected on  25-May-1991(i.e., “91145”: day 145 of 1991, A36 is the collection event referring to this specimen in Durden’s master catalog), and 017 after “GomezFarias” on the first label is the code for the locality “1 to 3k SSW El Aztecatowards Gomez Farias.”   Paratype: 1♂NVG-24015D04, the same data as the holotype, but  1–4 kmN of Gomez Farias,  350 m,  19-Aug-1972.   Fig. 134.Phylogenetic trees of  Vacerraconstructed from protein-coding regions in: a)the nuclear genome (autosomes) and b)the mitochondrial genome. Primary type specimens are labeled in magenta, and branches of selected species are colored differently:  V. gayra(green),  V. tama  sp. n.(magenta),  V. saltina  sp. n.(purple),  V. cecropterus stat. rest.(cyan),  V. cuza  sp. n.(red), and  V. hermesia(blue).   Fig. 135.  Vacerra tama  sp. n.males in dorsal (left) and ventral (right) views, data in text: a)holotype NVG-22056G03 and b)paratype NVG-24015D04.  Typelocality. Mexico: Tamaulipas, Gomez Farias,  1–3 kmsouth-southwest of El Aztecatowards Gomez Farias.   Etymology.The first two syllables of the Mexican state name with the typelocality of this species are used as the name. The name is treated as a noun in apposition.   Distribution.Currently known only from northeastern Mexico. 5281752493 1991-05-25 TMMC United States of America Austin 170 170 Biodiversity Center Austin 169 169 1 1 Texas holotype 5281752461 1972-08-19 TX, TMMC United States of America Austin 350 Biodiversity Center Austin 170 170 1 1 Texas paratype