Advancing butterfly systematics through genomic analysis Zhang, Jing Cong, Qian Shen, Jinhui Song, Leina Grishin, Nick V. The Taxonomic Report of the International Lepidoptera Survey 2025 2025-05-27 12 5 1 201 Grishin 2019 [555,877,1620,1653] Insecta Riodinidae Curvie GBIF Animalia Lepidoptera 15 167 Arthropoda genus subgen. nov.  http://zoobank.org/ AA5E15EB-F2B5-4675-8311-B776FC204789( Figs. 11part, 12, 13a)   Definition and diagnosis.This is the northeastern new species of  CurvieGrishin, 2019 ( typespecies  Symmachia emesiaHewitson, 1867), distributed in eastern Mexico. It is genetically differentiated from both  Curvie yucatanensis(Godman & Salvin, 1886), stat. rest.( typelocality in Mexico, Yucatán) and  Curvie emesia(Hewitson, 1867)( typelocality in Nicaragua) at the species level ( Fig. 11red vs. purple and blue); e.g., their Fst/ Gmin/COI barcode difference are 0.37/0.022/2.6% (17 bp) from  C. yucatanensisand 0.44/0.012/1.8% (12 bp) from  C. emesia. This new species differs from its relatives by the following combination of characters: a comparatively shorter aedeagus; a shorter basal segment of the valva; more curved in ventral view valvae with their distal ends directed posteriad, usually not diverging; and a shorter, bump-like transtilla in lateral view. Due to the cryptic nature of this species and significant individual variation, most reliable identification is achieved by DNA, and a combination of the following base pairs is diagnostic in the nuclear genome: cne312.12.3:A99 T, cne312.12.3:A156G, cne312.12.3: T177A, cne312.12.3:G312A, cne312.12.3:A474G; and COI barcode: 88C, T235C, 283 T, A472A, C526 T. Barcodesequence of a paratype. SampleNVG-5245, GenBank PV549980, 658 base pairs: AACATTATATTTTATTTTTGGTATTTGAGCAGGAATAGTAGGAACATCTTTAAGTTTATTAATTCGAATAGAATTAGGAACTTCTGGCTCTTTAATTGGAGATGATCAAATTTATAATACT ATTGTTACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGAAATTGACTTGTACCATTAATATTAGGAGCTCCAGATATAGCATTCCCTCGAA TAAATAATATAAGATTTTGACTTCTTCCCCCCTCATTATTTTTATTAATTTCAAGAAGAATTGTAGAAAATGGAGCAGGAACAGGATGAACAGTGTACCCCCCACTTTCTTCTAATATTGC TCATGGAGGATCATCAGTTGATTTAGCTATTTTTTCATTACATTTAGCTGGGATTTCTTCTATTTTAGGTGCTATTAATTTTATTACTACTATTATTAATATACGAGTAAATAATTTATCT TTTGATCAAATACCTTTATTTGTTTGATCAGTAGGTATTACTGCACTTTTACTTTTATTATCTTTACCCGTATTAGCAGGAGCAATTACTATATTACTAACTGATCGTAATTTAAATACAT CATTTTTTGACCCAGCAGGAGGAGGAGATCCCATTTTATACCAACACTTATTT   Type material.  Holotype: ♂ deposited in the National Museum of Natural History, Smithsonian Institution, Washington, DC, USA ( USNM), illustrated in Fig. 12a, bears the following three printed rectangular labels, two white: [ USA: TEXAS: Hidalgo Co.| 2 air mi SE of Relampago| Old Rio Rico Rd., ex larva | GPS: 26.0667°, -97.8837° | larva collected  13-Jun-2015| on Caesalpinia mexicana, adult ecl. | 4-Jul-2015, Grishin N.V.leg.], [DNA sample ID: | NVG-24103D07 | c/o Nick V. Grishin], and one red [HOLOTYPE ♂ | Curviewing | Grishin].   Fig. 12.  Curviewing sp. n.in dorsal (left) and ventral (right) views, data in text: a)holotype ♂ NVG-24103D07 and b)paratype ♀ NVG-24103D08. All  Curviespecimens (Figs. 12, 14–15) are shown at the same scale to facilitate comparisons.   Fig. 13.Male genitalia of  Curviein left lateral (left of the panel letter) and ventral (right of the panel letter) views, data in text or below: a) C. wing sp. n.paratype NVG-23112B10 from Mexico: Tamaulipas (tegumen with uncus and falces detached); b)  C. westwing  sp. n.paratype NVG-23111D09 from Mexico: Sinaloa; c)  C. westwing  sp. n.paratype NVG-23111D10 from Mexico: Colima; d)  C. yucatanensis stat. rest.NVG-23112B07 Mexico: Yucatán, Chichén Itzá, E. C. Welling leg., genitalia NVG240817-04 [CMNH]; e)  C. emesiaNVG-23111D11 Guatemala: Zacapa, genitalia NVG240817-03 [CMNH]; f)  C. emesiaNVG-23115B03, 92-SRNP-4214 Costa Rica: Guanacaste Conservation Area, Cuesta CanyonTigre, 270 m, eclosed 16-Aug- 1992, genitalia NVG240817-06 [USNM].   Paratypes: 18♂♂and 16♀♀in total: 8♂♂and 7♀♀data as the holotype except as stated:  1♂ NVG-347930-May,  2♂♂ NVG-3759and  NVG-376227-Jun, and ex larvae, found and reared on leaves of  Erythrostemon mexicanus(Gray 1861) Gagnon & Lewis 2016, eclosed on: 1♀11-Jun,  1♂and 1♀ NVG-24103D08( Fig. 12b) 12-Jun,  2♀♀27-Jun,  1♀29-Jun,  1♂2-Jul,  1♂6-Jul,  1♂and 1♀8-Jul,  1♀11-Jul, and  1♂13-Jul;  USA, Texas, Hidalgo Co.,  N.V. Grishinleg.: 1♀ Weslaco,  26-Nov-2004and  1♀ NVG-5245 Los Ebanos, 26.24259, −98.56121,  25-Nov-2015; and  Mexico: Tamaulipas: nr. El Abra, Paso del Abra, ex ova on  E. mexicanus, Roy O. Kendall& C. A. Kendallleg. [ TAMU]:  1♂ NVG-11913  15-Feb-1974, genitalia NVG190113-23and  1♀ NVG-11914  16-Feb-1974, genitalia NVG190113-24; Clench& Millerleg. [ CMNH]:  1♂ NVG-23112B11  0-3 miNW Gomez Farias,  9-Jan-1966and  1♂ NVG-23112B10  9 miW Soto la Marina,  8-Jan-1966, genitalia NVG240817-05 ( Fig. 13a); and  Ciudad Victoria: 1♂ NVG- 23112B12, 16-Aug-1962, H. A. Freemanleg. [ CMNH] and Rio San Marcos, John Kemnerleg. [ MGCL]:  1♂ NVG-24087D03,  1-Jan-1987and  1♀ NVG-24087D05,  29-Nov-1986;  Nuevo Leon: Cola de Caballo: Roy O. Kendall& C. A. Kendallleg., [ TAMU]:  1♂ NVG-11911  25-Oct-1979, genitalia NVG190113-21and  1♀ NVG-11912  23-Oct-1979, genitalia NVG190113-22and  1♀ NVG-24087C12  19-Jun-1986, I. L. Finkelsteinleg. [ MGCL];  1♀NVG-19044E12, AMNH_ IZC 00338007  Hacienda Vista Hermosa, Ville Santiago,  20-Jun-1940, Hoogstraal& Knightleg. [ AMNH]; and  1♂NVG-24087C11 Raices,  8-Jul-1986, John Kemnerleg. [ MGCL];  San Luis Potosí: Ciudad Valles: H. A. Freemanleg. [ CMNH]:  1♂ NVG-23112B08  3-Aug-1956and  1♀ NVG-23112B09  16-Jul-1970;  1♂ NVG-24087D06 Hwy 70,  22 kmW of Ciudad Valles,  17-Oct-1984, H. D. Baggettleg. [ MGCL]; and  1♀ NVG-24087D07 Hwy 85, ca.  15 miS Ciudad Valles,  22-Jun-1986, I. L. Finkelsteinleg. [ MGCL]; and  1♂NVG-19044E11, AMNH_ IZC 00338006  Veracruz, Jalapa, old [ AMNH].  Type locality. USA: Texas, Hidalgo Co., 2 air mi southeast of Relampago, Old Rio Rico Road, GPS 26.0667, −97.8837.   Etymology.The name is inspired by the English name “Curve-winged Metalmark” applied to this species in the U.S.and is treated as a noun in apposition.   Distribution.From South Texas, USA, through eastern Mexicoto Veracruz. 5281752384 Caesalpinia mexicana 2015-06-13 USNM Grishin N. V. United States of America Hidalgo Co. 26.0667 Old Rio Rico Rd. -97.8837 16 16 1 TEXAS holotype 5281752414 Caesalpinia mexicana 2015-05-30 NVG Grishin N. V. United States of America Hidalgo Co. Old Rio Rico Rd. 17 17 NVG-3479 1 1 TEXAS paratype 5281752422 [262,550,1643,1671] Caesalpinia mexicana 2015-05-30 NVG Grishin N. V. United States of America Hidalgo Co. 17 17 NVG-3759 2 2 TEXAS paratype 5281752551 [569,892,1643,1671] Caesalpinia mexicana 2015-06-27 NVG Grishin N. V. United States of America Hidalgo Co. Jun 17 17 NVG-3762 2 2 TEXAS paratype 5281752333 leaves of Erythrostemon mexicanus (Gray 1861) Gagnon & Lewis 2016 2015-06-11 NVG-24103D08 Grishin N. V. United States of America Hidalgo Co. Jun 17 17 3 2 1 TEXAS paratype 5281752318 leaves of Erythrostemon mexicanus (Gray 1861) Gagnon & Lewis 2016 2015-06-12 NVG-24103D08 Grishin N. V. United States of America Hidalgo Co. Jun 17 17 NVG-24103D08 3 2 1 TEXAS paratype 5281752527 [520,675,1716,1744] Caesalpinia mexicana 2015-06-27 Hidalgo Co., N. United States of America Hidalgo Co. Jul 17 17 NVG-24103D08 2 2 1 Texas paratype 5281752368 [684,822,1716,1744] leaves of Erythrostemon mexicanus (Gray 1861) Gagnon & Lewis 2016 2015-06-29 Hidalgo Co., N. United States of America Hidalgo Co. 17 17 NVG-24103D08 1 1 1 Texas paratype 5281752425 [831,950,1716,1744] Caesalpinia mexicana 2015-07-02 Hidalgo Co., N. United States of America Hidalgo Co. 17 17 NVG-24103D08 1 1 Texas paratype 5281752534 [959,1078,1716,1744] Caesalpinia mexicana 2015-07-06 Hidalgo Co., N. United States of America Hidalgo Co. 17 17 NVG-24103D08 1 1 Texas paratype 5281752388 [1087,1303,1716,1744] Caesalpinia mexicana 2015-07-08 Hidalgo Co., N. United States of America Hidalgo Co. 17 17 NVG-24103D08 1 1 1 Texas paratype 5281752410 [1312,1497,1716,1744] Caesalpinia mexicana 2015-07-11 V Hidalgo Co., N. United States of America Hidalgo Co. 17 17 NVG-24103D08 1 1 Texas paratype 5281752524 [134,272,1752,1780] Caesalpinia mexicana 2015-07-13 Hidalgo Co., N. United States of America Hidalgo Co. 17 17 NVG-24103D08 1 1 Texas paratype 5281752584 [283,1298,1752,1780] 2004-11-26 V N. V. Grishin United States of America Hidalgo Co. 17 17 1 1 1 Texas paratype 5281752378 2015-11-25 TAMU El Abra & C. A. Kendall Mexico 26.24259 Los Ebanos 1 -98.56121 Los Ebanos 17 17 NVG-5245 1 1 Tamaulipas paratype 5281752379 on E. mexicanus, Roy O. Kendall 2015-11-25 TAMU C. A. Kendall Mexico 26.24259 nr. El Abra 1 -98.56121 Los Ebanos 17 17 1 1 Tamaulipas paratype 5281752567 on E. mexicanus, Roy O. Kendall 1974-02-15 NVG C. A. Kendall Mexico 26.24259 nr. El Abra 1 -98.56121 Los Ebanos 17 17 NVG-11913 1 1 1 Tamaulipas paratype 5281752569 [532,920,1860,1888] 1974-02-16 CMNH Clench & Miller Mexico 17 17 NVG-11914, NVG190113 1 1 Tamaulipas paratype 5281752555 1974-02-16 CMNH Clench & Miller Mexico 17 17 NVG-11914, NVG190113 1 1 Tamaulipas paratype 5281752332 [328,1157,1897,1925] 1966-01-09 NVG Clench & Miller Mexico Gomez Farias 17 17 NVG-23112B11 1 1 Tamaulipas paratype 5281752415 1966-01-08 NVG Ciudad Victoria Mexico Ciudad Victoria 17 17 NVG-23112B10 1 1 Tamaulipas paratype 5281752406 [569,1117,1933,1961] 1966-01-08 NVG Ciudad Victoria Mexico Ciudad Victoria 17 17 NVG-23112B10 1 1 Tamaulipas paratype 5281752403 1966-01-08 NVG Ciudad Victoria Mexico 18 18 Ciudad Victoria Rio San Marcos 17 17 NVG-23112B10 1 1 Tamaulipas paratype 5281752485 [857,1494,104,132] 1966-01-08 NVG Ciudad Victoria Mexico Ciudad Victoria Rio San Marcos 18 18 NVG-23112B10 1 1 Tamaulipas paratype 5281752367 [134,561,140,168] 1987-01-01 NVG Ciudad Victoria Mexico Ciudad Victoria Rio San Marcos 18 18 NVG-24087D03 1 1 Tamaulipas paratype 5281752455 [628,1086,140,168] 1986-11-29 TAMU Mexico Nuevo Leon Rio San Marcos 18 18 NVG-24087D05 1 1 Nuevo Leon paratype 5281752373 1986-11-29 TAMU Roy O. Kendall & C. A. Kendall Mexico Cola de Caballo 18 18 1 1 Nuevo Leon paratype 5281752486 [772,1160,177,205] 1979-10-25 NVG Roy O. Kendall & C. A. Kendall Mexico Cola de Caballo 18 18 , NVG190113 1 1 Nuevo Leon paratype 5281752552 [1170,1498,177,205] 1979-10-25 NVG Roy O. Kendall & C. A. Kendall Mexico Cola de Caballo 18 18 NVG-190113-21 1 Nuevo Leon paratype 5281752458 [192,572,213,241] 1979-10-23 NVG Roy O. Kendall & C. A. Kendall Mexico Cola de Caballo 18 18 NVG-11912 1 1 Nuevo Leon paratype 5281752402 [591,921,213,241] 1986-11-29 NVG Roy O. Kendall & C. A. Kendall Mexico Cola de Caballo 18 18 NVG190113-22 1 1 Nuevo Leon paratype 5281752340 1986-06-19 MGCL I. L. Finkelstein Mexico Cola de Caballo 18 18 NVG-24087C12 1 1 Nuevo Leon paratype 5281752502 [485,1070,249,277] 1986-11-29 AMNH Roy O. Kendall & C. A. Kendall Mexico Cola de Caballo 18 18 IZC 00338007 1 1 Nuevo Leon paratype 5281752515 1940-06-20 AMNH Hoogstraal & Knight Mexico Ville Santiago Hacienda Vista Hermosa 18 18 1 Nuevo Leon paratype 5281752334 1956-08-03 1986-07-08 1956-08-03 MGCL, CMNH John Kemner & H. A. Freeman Mexico Ciudad Valles Raices 18 18 NVG-23112B08 2 2 San Luis Potosi paratype 5281752381 [518,1354,322,350] 1956-08-03 1986-07-08 1956-08-03 MGCL, CMNH John Kemner & H. A. Freeman Mexico Ciudad Valles Raices 18 18 NVG-23112B08 2 2 San Luis Potosi paratype 5281752535 1956-08-03 1986-07-08 1956-08-03 MGCL, CMNH John Kemner & H. A. Freeman Mexico Ciudad Valles Raices 18 18 NVG-23112B08 1 1 San Luis Potosi paratype 5281752556 [501,927,358,386] 1970-07-16 1986-07-08 1956-08-03 NVG John Kemner & H. A. Freeman Mexico Ciudad Valles Raices 18 18 NVG-23112B09 1 1 San Luis Potosi paratype 5281752398 1984-10-17 MGCL H. D. Baggett Mexico Hwy 70 18 18 NVG-24087D06 1 1 San Luis Potosi paratype 5281752538 1986-06-22 MGCL I. L. Finkelstein Mexico Hwy 85 18 18 NVG-24087D07 1 1 San Luis Potosi paratype 5281752471 1986-06-22 AMNH I. L. Finkelstein Mexico Hwy 85 18 18 IZC 00338006 1 1 San Luis Potosi paratype 5281752361 [270,672,466,494] AMNH Mexico Jalapa 18 18 1 Veracruz paratype