Advancing butterfly systematics through genomic analysis Zhang, Jing Cong, Qian Shen, Jinhui Song, Leina Grishin, Nick V. The Taxonomic Report of the International Lepidoptera Survey 2025 2025-05-27 12 5 1 201 Grishin Grishin 2025 [504,928,814,847] Insecta Hesperiidae Entheus Animalia Lepidoptera 48 48 Arthropoda species proxemus  http://zoobank.org/ 4EE1D5A2-1A38-4181-92C5-41E59B1C5AB2( Figs. 31part, 36e–g, 39, 50 part, 51i)   Definition and diagnosis.Genomic analysis of  EntheusHübner, [1819]( typespecies  Papilio peleusLinnaeus, 1763, which is a junior subjective synonym of  Papilio priassus Linnaeus, 1758) reveals that a male from Pará, Brazil, is sister to  Entheus telemus Mabille, 1898( typelocality in Brazil), but is genetically differentiated from it at the species level ( Figs. 31, 50); e.g., their COI barcodes differ by 1.5% (10 bp, a difference large for  Entheus), thus representing a new species. This new species keys to “  Entheus priassus telemus” (B.10.4(b)) in Evans (1952) but differs from its relatives by a combination of the following characters in males (female unknown): forewing bands are yellower (not intensely orange as in  E. telemus), especially the subapical band and the spot between the bands, and narrower, i.e., the distal and basal margins of the discal band are more straight, the distal margin is not engulfing half of the posterior margin of the spot between the bands; the subapical band is broadly connected with the discal band from the anterior end of the discal cell towards the costa; the hindwing is entirely dark brown on both sides. Due to the cryptic nature of this species and unexplored individual variation, most reliable identification is achieved by DNA, and a combination of the following base pairs is diagnostic in the nuclear genome: aly 2487.1.3:G54A, aly 2487.1.3:T63C, aly127.63.3:T1122C, aly3319.1.10:A153G, aly1042. 29.12:A108C, aly 2954.6.6:T306T (not C), aly26.15.3:A48A (not T), aly363.10.3:A258A (not T), aly7917.5.6: T384T (not C), aly 1036.5.1:A807A (not T); and COI barcode: A28A, T127T, C367T, G506A, 526C, A562G.   Fig. 39.  Entheus proxemus  sp. n.holotype ♂ NVG-23064B05 in dorsal (left) and ventral (right) views, data in text.  Barcode sequence of the holotype. Sample NVG-23064B05, GenBank PV549995, 658 base pairs: AACTTTATATTTTATTTTCGGAATTTGAGCAGGAATAGTAGGAACTTCCTTAAGATTATTAATTCGAACTGAATTAGGAACTCCTGGATCATTAATTGGAGATGATCAAATTTATAATACT ATTGTTACTGCACATGCTTTTATTATAATTTTTTTTATAGTTATACCAATTATAATTGGAGGATTTGGAAATTGATTAGTACCTTTAATATTAGGAGCTCCTGACATAGCTTTTCCTCGAA TAAATAATATAAGTTTTTGACTCTTACCCCCATCATTAACATTATTAATTTCTAGAAGAATTGTTGAAAATGGAGCTGGAACAGGATGAACTGTTTACCCCCCTTTATCTGCTAATATTGC CCATCAAGGATCTTCTGTAGATTTAGCCATTTTTTCCCTTCATTTAGCTGGAATTTCATCAATTTTAGGAGCTATTAATTTTATTACAACAATTATTAATATACGTATTAGAAATTTATCA TTTGATCAAATACCTCTATTTATTTGAGCAGTAGGTATTACCGCATTACTTTTATTATTATCTTTACCTGTATTAGCGGGTGCTATTACTATACTTTTAACAGATCGAAATTTAAATACAT CATTTTTTGATCCTGCAGGAGGAGGAGATCCTATTCTTTATCAACATTTATTT    Type material. Holotype: ♂deposited in the McGuire Center for Lepidopteraand Biodiversity Collection, Gainesville, FL, USA ( MGCL), illustrated in Figs. 39and 51i(genitalia Fig. 36e–g), bears the following seven printed rectangular labels, six white: [ Belém, Pará| Brazil|  January 11, 1961| D.L.Lindsley], [ Entheus Hübner| priassus (Linnaeus)| telemus Mabille], [ D.L. Lindsleycolln. | MGCL Accession | # 2008-20], [DNA sample ID: | NVG-23064B05 | c/o Nick V. Grishin], [DNA sample ID: | NVG-24064A01 | c/o Nick V. Grishin], [genitalia: | NVG241111-01 | c/o Nick V. Grishin], and one red [HOLOTYPE ♂ | Entheus| proxemus Grishin]. The first DNA sample (sequenced) refers to the extraction from a leg and the second (stored) is from the abdomen prior to genitalia dissection.   Typelocality. Brazil: Pará, Belém.   Etymology.The name is constructed as an antonym of its sister species’ name,  telemus. In Greek, τηλε- ( tele-) is a prefix that means distant or far away. In Latin, proximusmeans nearest or next, and the name formed from this word is given to this species, nearest to  E. telemus, with the distribution next to it. The name is treated as a masculine noun in apposition.   Distribution.Currently known only from the holotypecollected in the lower Amazonian region. 5281752311 1961-01-11 MGCL D. L. Lindsley Brazil Belem Belem 49 49 1 1 Para holotype