Advancing butterfly systematics through genomic analysis Zhang, Jing Cong, Qian Shen, Jinhui Song, Leina Grishin, Nick V. The Taxonomic Report of the International Lepidoptera Survey 2025 2025-05-27 12 5 1 201 Grishin Grishin 2025 [536,896,675,708] Insecta Hesperiidae Entheus Animalia Lepidoptera 55 55 Arthropoda species guato  http://zoobank.org/ 27E9B5AA-849F-4216-9962-841BA9008949( Figs. 43d, 44 part, 45, 50 part, 51m)   Definition and diagnosis.Based on an illustration of a spread non-syntypic specimen in Godman and Salvin (1894), Steinhauser (1989)identified specimens from southeastern Chiapas, Mexico(near the border with Guatemala) as  Entheus mathoGodman & Salvin, 1879(type locality in Nicaragua: Chontales), as discussed above. According to the taxonomic identity of the  E. matho lectotypedesignated above, these specimens are not conspecific with  E. mathoand represent a new species. This species is sister to  Entheus crux Steinhauser, 1989( Veracruz, Mexico: Veracruz, Catemaco) and is more genetically distant from  E. matho( Figs. 44, 50), e.g., its COI barcodes differ by 0.9% (6 bp) from  E. cruxand by 2.9% (19 bp) from  E. matho. The description and diagnosis for this new species were given by Steinhauser (1989)for  E. matho, because Steinhauser’s  E. mathois simply this new species, which he misidentified. In particular, Steinhauser (1989)differentiated it from his newly described  E. crux, illustrating male and female genitalia of both species. This new species differs from both  E. mathoand  E. cruxby a narrower harpe with a straighter ventral margin ( Fig. 43d), but the harpe is much broader with its ventral margin convex in  E. matho( Fig. 43a–c). In facies, males of this new species differ from its relatives by more extensive red overscaling above, frequently with a well-developed reddish arc from the base of the forewing discal cell (as in females); and by a straight and broad array of the subapical semi-hyaline amber spots with the two posterior spots not being offset distad along the inner margin of this subapical band as in typical E. matho. The hindtibial tuft is tawny, approximately the same color as thereddish overscaling of the dorsal side. In DNA, a combination of the following base pairs is diagnostic in the nuclear genome: aly18826.3.2:A51T, aly18826.3.2:T90C, aly318.26.5:C150T, aly2627.18.2:C81T, aly5294.4.3:T120A; and COI barcode: 49T, T59T, T133C, T499C, A628G.   Fig. 45.  Entheus guato  sp. n.holotype ♂ NVG-15105A05 in dorsal (left) and ventral (right) views, data in text. Barcode sequence of the holotype. Sample NVG-15105A05, GenBank PV549999, 658 base pairs: AACTTTATATTTTATTTTCGGAATCTGAGCAGGAATAGTAGGTACTTCTTTAAGATTATTAATTCGAACTGAATTAGGAACTCCTGGATCATTAATTGGAGATGATCAAATTTATAATACT ATTGTTACTGCCCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGGGGTTTTGGAAATTGACTAGTACCTTTAATATTGGGAGCCCCTGATATAGCTTTCCCTCGAA TAAATAACATAAGTTTTTGACTTCTACCCCCATCATTAACATTGTTAATTTCTAGAAGAATTGTCGAAAATGGAGCTGGAACAGGATGAACAGTTTACCCCCCTTTATCTGCTAATATTGC CCACCAAGGATCTTCAGTAGATTTAGCTATTTTCTCCCTTCATTTAGCTGGTATTTCATCAATTTTAGGAGCTATTAATTTTATTACAACAATTATTAATATACGAATTAGAAACTTATCA TTTGATCAAATACCCCTATTTGTTTGAGCAGTAGGTATTACCGCACTACTTTTATTATTATCTTTACCTGTATTAGCAGGTGCTATTACTATACTTTTAACAGATCGAAATTTAAATACAT CATTTTTTGATCCTGCAGGAGGGGGAGATCCAATTCTTTATCAACATTTATTT   Type material.  Holotype: ♂deposited in the collection of the California Academy of Sciences, San Francisco, CA, USA ( CAS), illustrated in Figs. 45and  51m, bears the following six printed (text in italics handwritten) rectangular labels, five white: [ MEX., Chiapas, |  27 km. S.E. Sta. Rosa| June ’69; P. Hubbell], [Collection of | C. D. MacNeill], [  Entheus matho|  mathoG.&S.| Det. C.D. MacNeill '87], [] both antennae and a leg are glued to this label, no text, [DNA sample ID: | NVG-15105A05 | c/o Nick V. Grishin], and one red [HOLOTYPE ♂ | Entheus| guato Grishin].   Paratypes:5♂♂ and 1♀: Mexico, Chiapas: 1♂NVG-14101C03 no detailed locality, coll. Franck Johnson, genitalia slide G2176 [ AMNH] and Comitán, Santa Rosa, T. Escalanteleg. [ MGCL]:  1♂NVG-23064A12, Specimen no. 29216,  Apr-1959,  1♂NVG-23064A11, Specimen no. 29217,  Feb-1960,  1♂NVG-15026F08, Specimen no. 29215,  Apr-1968, and  1♀NVG-15026F09, Specimen no. 29220,  Apr-1968, genitalia SRS-1211; and  1♂ BMNH(E) #1054213 Guatemala, Alta Verapaz Department, Senahú, Championleg. [ BMNH].   Typelocality. Mexico: Chiapas, Comitán,  27 kmsoutheast of Santa Rosa.   Etymology.The name is given for the locality of the specimen misidentified and illustrated by Godman and Salvin (1894) as  E. matho. The name is treated as a masculine noun in apposition.   Distribution. Mexico: Chiapas(near the border with Guatemala) and Guatemala.   Comment.The specimen with better DNA preservation was selected as the holotype. 5281752426 CAS P. Hubbell Mexico C. D. MacNeill Comitan 56 56 1 1 Chiapas holotype 5281752407 AMNH P. Hubbell Mexico C. D. MacNeill Chiapas Comitan 56 56 1 1 Chiapas paratype 5281752501 [331,1007,685,713] MGCL T. Escalante Mexico C. D. MacNeill Santa Rosa Comitan 56 56 1 1 Santa Rosa paratype 5281752529 1959-04 CAS P. Hubbell Mexico C. D. MacNeill Comitan 56 56 1 1 Chiapas paratype 5281752434 [378,1081,721,749] 1960-02 CAS P. Hubbell Mexico C. D. MacNeill Comitan 56 56 1 1 Chiapas paratype 5281752401 1968-04 CAS P. Hubbell Mexico C. D. MacNeill Comitan 56 56 1 1 Chiapas paratype 5281752331 [482,1497,757,785] 1968-04 CAS P. Hubbell Mexico C. D. MacNeill Comitan 56 56 1 1 1 Chiapas paratype 5281752492 [134,1389,793,821] BMNH Champion Guatemala C. D. MacNeill Senahu Senahu 56 56 1 1 Alta Verapaz Department paratype