Advancing butterfly systematics through genomic analysis Zhang, Jing Cong, Qian Shen, Jinhui Song, Leina Grishin, Nick V. The Taxonomic Report of the International Lepidoptera Survey 2025 2025-05-27 12 5 1 201 Grishin Grishin 2025 [491,942,274,307] Insecta Hesperiidae Entheus Animalia Lepidoptera 58 58 Arthropoda species venezuelius  http://zoobank.org/ 3DE8615E-5BAB-43AB-8EDD-DEA0B421FCF3( Figs. 36p–z, 44part, 47, 50 part, 51o–p)   Definition and diagnosis.Genomic analysis reveals that specimens from Venezuelathat are traditionally identified as  Entheus aequatoriusMabille & Boullet, 1919, stat. rest.( typelocality given in the original description as “ Bolivia” likely by mistake, and may be in Ecuador: Bolivar), are indeed its sister, but are genetically differentiated from it at the species level ( Figs. 44, 50); e.g., their COI barcodes differ by 1.2% (8 bp), thus representing a new species. This new species keys to “  Entheus matho aequatorius”(B.10.5(c)) in Evans (1952) who included it into this taxon, but noted that Venezuelan specimens were “smaller, ♀upf with spot mid costa,” and differs from its relatives by a combination of the following characters: smaller in size; males with more extensive rusty overscaling on both sides of the wings, the color of the forewing bands and spots is yellower, less orange; the tibial tuft is tawny, paler than in  E. aequatorius; the pale area of the anal fold is smaller and yellower; females with a white area on the hindwing more restricted towards the anal margin and a pale spot by mid-costa on the forewing aligned with the discal cell white spot, not offset basad. Due to the cryptic nature of this species and unexplored individual variation, most reliable identification is achieved by DNA, and a combination of the following base pairs is diagnostic in the nuclear genome: aly2653.1.9:C117G, aly2130.3.5:T153C, aly997.1.7:T42A, aly671.50.4:C147 T, aly  2874.5.3:G177A; and COI barcode: T49C, T115C, T226C, A373G, G506G, T646C.   Fig. 47.  Entheus venezuelius  sp. n.in dorsal (left) and ventral (right) views, data in text: a)holotype ♂ NVG-15026F10, inset shows hindtibial tuft enlarged two times compared to specimens (scale not given) and b)paratype ♀ NVG-15026F11. Barcode sequence of the holotype. Sample NVG-15026F10, GenBank PV550001, 658 base pairs: AACTTTATATTTTATTTTCGGAATCTGAGCAGGAATAGTAGGTACTTCCCTAAGATTATTAATTCGAACTGAATTAGGAACTCCTGGATCATTAATTGGAGATGATCAAATTTACAATACT ATTGTTACTGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCAATTATAATTGGAGGTTTTGGAAATTGATTAGTACCTTTAATATTAGGAGCCCCTGACATAGCTTTTCCTCGAA TAAATAATATAAGTTTTTGACTTCTACCCCCATCATTAACATTATTAATTTCTAGAAGAATTGTTGAAAATGGAGCTGGAACAGGATGAACAGTTTACCCCCCTTTATCTGCTAACATTGC CCACCAAGGGTCTTCAGTAGATTTAGCTATTTTTTCCCTTCATTTAGCTGGTATTTCATCAATTTTAGGAGCTATTAATTTTATTACAACAATTATTAATATACGAATTAGAAATTTATCA TTTGATCAAATACCTTTATTTGTTTGAGCAGTAGGTATTACTGCACTACTTTTATTATTATCTTTACCTGTATTAGCAGGTGCTATTACTATACTTTTAACAGATCGAAATTTAAATACAT CATTTTTTGATCCTGCGGGAGGAGGAGATCCAATTCTTTACCAACATTTATTT   Type material.  Holotype: ♂deposited in the McGuire Center for Lepidopteraand Biodiversity Collection, Gainesville, FL, USA ( MGCL), illustrated in Figs. 47aand 51o(genitalia Fig. 36p–w), bears the following five printed (text in italics handwritten) rectangular labels, four white: [ Rancho Grande. 1200 m. | Parque Nac. Henri Pittier| Edo. Aragua, Venezuela| T.E. Pliske VI-29-75], [Genit. Prep. | SRS- 1278], [Allyn Museum | Acc. 19 80-29], [DNA sample ID: | NVG-15026F10 | c/o Nick V. Grishin], and one red [HOLOTYPE ♂ | Entheus| venezuelius Grishin].   Paratypes:2♂♂ and 2♀♀ from Venezuela, Argua: 1♀NVG-15026F11 the same data as the holotype, genitalia SRS-1279 ( Figs. 47b, 51p) and  1♀NVG-14062C01 Eancho Grande,  1100 m,  19-Jun-1985, S. S. Nicolayleg. [ USNM];  1♂NVG-14113A05 Yuracay, Hacienda Tropicaleca.  10 kmS of San Felipe,  100–400 m, GPS 10.2917, −68.6667,  26-Jan-23-Feb-1993, Kareofelas& Withamleg. [ LACM]; and  1♂NVG-15032C11 (leg DNA extraction, sequenced), NVG-24028H11 (abdomen DNA extraction and dissection) Carabobo, Puerto Cabello, no date [around 1900], Hahnelleg., genitalia vial NVG241114-17 ( Fig. 36x–z) [ MFNB].   Typelocality. Venezuela: Aragua, Henri Pittier National Park, Rancho Grande, elevation 1200 m.   Etymology.The name is given for the country with the typelocality and to rhyme with its related species,  E. aequatorius. The name is treated as an adjective.   Distribution. Venezuela. 5281752540 1975-06-29 MGCL T. E. Pliske Venezuela 1200 Rancho Grande 59 59 1 1 holotype 5281752327 1975-06-29 MGCL T. E. Pliske Venezuela 0 Argua Argua 59 59 1 1 paratype 5281752432 [192,1356,612,640] 1985-06-19 USNM S. S. Nicolay Venezuela 1100 Eancho Grande 59 59 1 1 paratype 5281752350 1993-01-26 1993-02-23 1993-01-26 LACM Kareofelas & Witham Venezuela 250 10.2917 Hacienda Tropicale 7 -68.6667 Yuracay 59 59 1 1 paratype 5281752355 1975-06-29 MFNB Hahnel Venezuela 0 Puerto Cabello Puerto Cabello 59 59 NVG241114 1 1 Carabobo paratype