Advancing butterfly systematics through genomic analysis Zhang, Jing Cong, Qian Shen, Jinhui Song, Leina Grishin, Nick V. The Taxonomic Report of the International Lepidoptera Survey 2025 2025-05-27 12 5 1 201 Grishin Grishin 2025 [433,999,910,943] Insecta Hesperiidae Urbanus Animalia Lepidoptera 71 71 Arthropoda species elma Urbanoides  http://zoobank.org/ D77594CE-FE05-4EF4-94B2-5B45443632F7 ( Figs. 58part, 59)   Definition and diagnosis.A close sister to  Urbanus elminaEvans, 1952( typelocality in Ecuador: Rio Pastaza), this new species keys to it (C.13.9) in Evans (1952) and Steinhauser (1981)and was included by them in that taxon, but is genetically differentiated from it at the species level ( Fig. 58); e.g., their COI barcodes differ by 3.2% (21 bp). The new species shares with  U. elminaits “washed out appearance” of ventral hindwing markings ( Steinhauser 1981), i.e., darker bands are not prominent and are poorly contrasting with the ground color, but differs from  U. elminaby a narrower and more elongated toward the tail hindwing and in females a narrower hindwing tail, wider semi-hyaline spots (e.g., in the forewing cell CuA 1-CuA 2), a more extended semi-hyaline spot reaching (and in females crossing) the middle of the forewing cell CuA 2-1A+2A, and slightly bluer (rather than greener) overscaling on the dorsal hindwing of females. Due to the cryptic nature of this species and unexplored individual variation, most reliable identification is achieved by DNA, and a combination of the following base pairs is diagnostic in the nuclear genome: aly27.17.6:C102G, aly3446.3.6:A40C, aly814.24.5:C36T, aly707.13.2:A96G, aly2178.51.8: A106G; and COI barcode: T43C, C220T, A268G, T439C, T581C, A619G.   Fig. 58.Phylogenetic trees of selected  Urbanus( Urbanoides)species (  U. elma  sp. n.in red and  U. elminain blue) constructed from protein-coding regions in: a)the Z chromosome, based on 615,213 positions, and b)the mitochondrial genome. Ultrafast bootstrap ( Minh et al. 2013) values are shown at nodes.   Fig. 59.  Urbanus( Urbanoides) elma  sp. n.in dorsal (left) and ventral (right) views, data in text: a)holotype ♀ NVG-19064C09 from Venezuela and b)paratype ♂ NVG-24019F07 from Colombia. Barcode sequence of the holotype. Sample NVG-19064C09, GenBank PV550008, 658 base pairs: AACCTTATATTTTATTTTTGGAATTTGAGCAGGATTAATTGGCACTTCATTAAGATTACTTATTCGAACTGAATTAGGAACCCCCGGATCTTTAATTGGAGATGATCAAATTTATAATACT ATTGTAACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGTAATTGATTAATCCCCTTAATAATAGGAGCTCCTGATATAGCTTTCCCCCGTA TAAATAATATAAGATTTTGATTATTGCCACCTTCACTAACTTTATTAATCTCAAGAAGAATTGTTGAAAATGGTGCCGGTACTGGATGAACAGTTTATCCCCCCCTTTCATCTAATATTGC CCATCAAGGAGCTTCTGTTGATTTAGCAATTTTTTCTCTACATCTTGCAGGTATTTCATCTATTCTTGGAGCTATCAATTTTATTACAACAATTATTAATATACGAATTAATAATTTATCT TTTGATCAAATACCTTTATTTGTTTGAGCTGTAGGAATTACAGCATTATTATTACTATTATCTTTACCTGTTTTAGCAGGAGCTATTACTATATTACTAACTGATCGAAATTTAAATACCT CCTTTTTTGATCCGGCAGGAGGAGGAGATCCAATTTTATATCAACATTTATTT   Type material.  Holotype: ♀deposited in the Bohart Museum of Entomology, University of California, Davis, CA, USA ( UCDC), illustrated in Fig. 59a, bears the following five printed rectangular labels, four white: [ Merida| Libertador| Merida VZLA |  VII 3 1979], [ J McLaughlin| A A Grigarick| R O Schuster| R W Brooks], [ Urbanus elmina Evans, 1952| female | Det. A. D. Warren, 2000], [DNA sample ID: | NVG-19064C09 | c/o Nick V. Grishin], and one red [HOLOTYPE ♀ | Urbanus (Urbanoides) elma Grishin].   Paratype: 1♂NVG-24019F07 Colombia(no details), 1901, Stichel[ SMF] ( Fig. 59b).   Typelocality. Venezuela: Merida, Libertador, Merida.   Etymology.The name is formed from the name of its sister species,  U. elmina, made shorter to indicate the more northern distribution of the new species. The name is a noun in apposition.   Distribution.Currently known from Colombiaand Venezuela. 5281752321 1979-07-03 UCDC J McLaughlin & A A Grigarick & R O Schuster & R W Brooks Venezuela A. D. Warren Merida 72 72 1 1 holotype 5281752581 [265,1365,1764,1792] SMF Stichel Colombia Colombia 72 72 1 1 paratype