Anahita medog S. Li & Yao, 2022
publication ID |
https://dx.doi.org/10.3897/BDJ.10.e96003 |
publication LSID |
lsid:zoobank.org:pub:2A9D4A67-DC00-40DC-9745-BF531D767F55 |
persistent identifier |
https://treatment.plazi.org/id/FF71E5C3-DA0C-58D9-9400-968831F657BF |
treatment provided by |
|
scientific name |
Anahita medog S. Li & Yao |
status |
sp. n. |
Anahita medog S. Li & Yao sp. n.
Materials
Type status: Holotype. Occurrence: recordedBy: J. Wu; individualCount: 1; sex: male; lifeStage: adult; Taxon: order: Araneae ; family: Ctenidae ; genus: Anahita ; Location : country: China; stateProvince: Tibet; municipality: Nyingchi ; locality: Medog County ; verbatimLocality: Baibung Town , near the Jiagagou Bridge ; verbatimElevation: 805 m a.s.l.; verbatimLatitude: 29°15.067'N; verbatimLongitude: 95°11.717'E; Event: samplingProtocol: Collected by hand in leaf litter; year: 2016; month: 6; day: 18; Record Level: institutionCode: IZCAS-Ar 43536 Type status: Paratype. Occurrence: recordedBy: J. Wu; individualCount: 1; sex: female; lifeStage: adult; Taxon: order: Araneae ; family: Ctenidae ; genus: Anahita ; Location : country: China; stateProvince: Tibet; municipality: Nyingchi ; locality: Medog County ; verbatimLocality: Baibung Town , near the Jiagagou Bridge ; verbatimElevation: 805 m a.s.l.; verbatimLatitude: 29°15.067'N; verbatimLongitude: 95°11.717'E; Event: samplingProtocol: Collected by hand in leaf litter; year: 2016; month: 6; day: 18; Record Level: institutionCode: IZCAS-Ar 43537 GoogleMaps GoogleMaps GoogleMaps GoogleMaps
Description
Male (IZCAS-Ar 43536): PL 2.7, PW 2.3, AW 0.9, OL 2.4, OW 1.4. Eye diameters and interdistances: AME 0.13, ALE 0.10, PME 0.22, PLE 0.19, AME-AME 0.10, AME-ALE 0.22, PME-PME 0.16, PME-PLE 0.23, AME-PME 0.11, ALE-PLE 0.14, clypeus AME 0.10, clypeus ALE 0.37. Palp and leg measurements: palp 4.1 (1.5, 0.6, 0.8, -, 1.2), I missing, II 13.0 (3.6, 1.2, 3.7, 3.3, 1.2), III 10.9 (2.8, 1.1, 2.8, 3.0, 1.2), IV 16.0 (4.1, 1.1, 4.2, 5.1, 1.5). Leg formula 4123. Spination of palp and legs: palp 023, 000, 0211; femora II p112, d111, r012, III p112, d111, r112, IV p112, d111, r012; patellae II-IV 101; tibiae II p110, d101, r100, v22222, III p11, d111, r11, v222, IV p11, d111, r11, v22; metatarsi II p111, r111, v222, III p112, d010, r112, v222, IV p112, d010, r112, v2222. Chelicerae with 3 promarginal, 4 + 1 retromarginal teeth and with elongated patch of 6 tiny denticles along entire cheliceral furrow. Leg claws II with 9, III with 5 and IV with 7 secondary teeth. Position of tarsal organ: II 1.06, III 0.85, IV 1.14.
Palp (Fig. 10 View Figure 10 a-c). Palpal tibia without RTA and intrasegmental sclerite, distally with retrolateral stout spine. Cymbium tip conical. Embolus (Fig. 14 a) arising at 6.30 o’clock position, with wide base and narrow tip and a membranous apophysis apically. Conductor absent. Tegular apophysis arising nearly centrally from tegulum.
Colour (Fig. 11 View Figure 11 c and d). Black to yellowish. Dorsal prosoma with two parallel black lateral bands and distinctly marked fovea. Sternum, ventral coxae, labium and gnathocoxae yellowish. Chelicerae yellowish with longitudinal lines. Palps and legs yellowish. Dorsal opisthosoma black with light median band. Lateral opisthosoma spotted. Ventral opisthosoma yellowish with lateral black patterns. Spinnerets dark.
Female (IZCAS-Ar 43537): PL 2.9, PW 2.4, AW 1.2, OL 3.5, OW 2.0. Eye diameters and interdistances: AME 0.13, ALE 0.11, PME 0.19, PLE 0.18, AME-AME 0.13, AME-ALE 0.26, PME-PME 0.21, PME-PLE 0.24, AME-PME 0.15, ALE-PLE 0.17, clypeus AME 0.10, clypeus ALE 0.38. Palp and leg measurements: palp 3.2 (0.9, 0.6, 0.8, -, 0.9), I 10.4 (2.9, 1.3, 3.1, 2.2, 0.9), II 9.3 (2.7, 1.2, 2.5, 2.0, 0.9), III 8.3 (2.3, 1.1, 2.1, 2.0, 0.8), IV 12.4 (3.3, 1.2, 3.1, 3.6, 1.2). Leg formula 4123. Spination of palp and legs: palp 020, 010, 010, 2012; femora I p011, d111, r021, II p011, d111, r011, III p012, d111, r112, IV p002, d111, r012; patellae I-II 000, III-IV 101; tibiae I v22212, II v22222, III-IV p11, d111, r11, v222; metatarsi I-II v222, III p112, d010, r112, v222, IV p112, r112, v2222. Chelicerae with 3 promarginal, 4 retromarginal teeth and with elongated patch of 5 tiny denticles along entire cheliceral furrow. Palpal claw with 5 secondary teeth, leg claws I-II with 5, III with 4 and IV with 7 secondary teeth. Position of tarsal organ: I 0.79, II 0.72, III 0.70, IV 1.00.
Copulatory organ (Fig. 11 View Figure 11 a and b). Lateral teeth arising posteriorly from median plate. Median plate with a large n-shaped sclerite. Copulatory openings hidden under median plate. Copulatory ducts nearly triangular. Spermathecae nearly cylindrical. Fertilisation ducts pointing anteriorly.
Colour (Fig. 11 View Figure 11 e and f). As in male.
Diagnosis
Small Ctenidae (total length male 5.1, female 6.4). The species resembles A. maolan Zhu, Chen & Song, 1999 (see Zhu et al. 1999: figs 1-5; Yin et al. 2012: fig. 473a-e; Marusik and Omelko 2016: figs 1-13 and 32-34) by having similar distal retrolateral spine, tegular apophysis (Fig. 10 View Figure 10 a-c) and fertilisation ducts (Fig. 11 View Figure 11 b), but can be distinguished by the embolus arising at 6.30 o’clock position, its tip with membranous apophysis (Fig. 10 View Figure 10 b and Fig. 14 a; embolus arising centrally from tegulum, its tip without membranous apophysis in A. maolan ), by the median plate with a large n-shaped sclerite (Fig. 11 View Figure 11 a; absent in A. maolan ), by the lateral teeth pointing postero-medially (Fig. 11 View Figure 11 a; lateral teeth pointing medially in A. maolan ) and by the spermathecae nearly cylindrical (Fig. 11 View Figure 11 b; spermathecae nearly wavy in A. maolan ).
Etymology
The specific name refers to the type locality and is a noun in apposition.
Distribution
China (Tibet, type locality; Fig. 1 View Figure 1 ).
DNA Barcode
Male (IZCAS-Ar 43536):.
TGTTTGGAGCTTGAGCTGCTATAGCTGGAACAGCAATAAGAGTTTTAATTCGAATGGAATTAGGACATTCTGGTAGATTGTTAGGAGATGATCATTTATATAATGTAATTGTAACGGCTCATGCTTTTGTTATAATTTTTTTTATAGTAATACCTATTTTGATTGGGGGCTTTGGTAATTGGTTGGTTCCTTTAATGTTAGGGGCTCCGGATATATCTTTTCCTCGAATAAATAATTTATCCTTTTGATTATTACCGCCTTCTTTATTTTTGTTGTTTATATCTTCTATAGTTGAGATAGGGGTTGGAGCAGGTTGAACGGTTTATCCTCCTTTAGCTTCTAGAATTGGGCATATGGGAAGTTCAATGGATTTTGCTATTTTTTCTTTACATTTAGCAGGTGCTTCTTCTATTATAGGTGCTGTGAATTTTATTTCTACTATTATTAATATACGATTAATAGGAATAACAATGGAGAAGATCCCTTTATTTGTATGATCGGTTTTTATTACTGCAATTTTATTATTATTATCTTTACCTGTTTTAGCAGGAGCTATTACTATATTATTGACTGATCGAAATTTTAATACTTCTTTTTTTGACCCTGCTGGAGGTGGAGATCCTATTTTATTTCAACATTTATTTTGATTTTTTG (GenBank accession number OP572101).
Female (IZCAS-Ar 43537):
TGTTTGGAGCTTGAGCTGCTATAGCTGGAACAGCAATAAGAGTTTTAATTCGAATGGAATTAGGACATTCTGGTAGATTGTTAGGAGATGATCATTTATATAATGTAATTGTAACGGCTCATGCTTTTGTTATAATTTTTTTTATAGTAATACCTATTTTGATTGGGGGCTTTGGTAATTGGTTGGTTCCTTTAATGTTAGGGGCTCCGGATATATCTTTTCCTCGAATAAATAATTTATCCTTTTGATTATTACCGCCTTCTTTATTTTTGTTGTTTATATCTTCTATAGTTGAGATAGGGGTTGGAGCAGGTTGAACGGTTTATCCTCCTTTAGCTTCTAGAATTGGGCATATGGGAAGTTCAATGGATTTTGCTATTTTTTCTTTACATTTAGCAGGTGCTTCTTCTATTATAGGTGCTGTGAATTTTATTTCTACTATTATTAATATACGATTAATAGGAATAACAATGGAGAAGATCCCTTTATTTGTATGATCGGTTTTTATTACTGCAATTTTATTATTATTATCTTTACCTGTTTTAGCAGGAGCTATTACTATATTATTGACTGATCGAAATTTTAATACTTCTTTTTTTGACCCTGCTGGAGGTGGAGATCCTATTTTATTTCAACATTTATTTTGATTTTTTG (GenBank accession number OP572102).
No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.