Nematovomyces Tedersoo & Esmaeilzadeh-Salestani, 2025

Tedersoo, Leho, Hosseyni Moghadam, Mahdieh S., Panksep, Kristel, Prins, Victoria, Anslan, Sten, Mikryukov, Vladimir, Bahram, Mohammad, Abarenkov, Kessy, Kõljalg, Urmas, Esmaeilzadeh-Salestani, Keyvan, Pawłowska, Julia, Wurzbacher, Christian, Ding, Yi, Alkahtani, Saad Hussin & Nilsson, R. Henrik, 2025, Thirty novel fungal lineages: formal description based on environmental samples and DNA, MycoKeys 124, pp. 1-121 : 1-121

Nematovomyces Tedersoo & Esmaeilzadeh-Salestani gen. nov.

Type species.

Nematovomyces vermicola (G. L. Barron & Szuarto) Tedersoo & Esmaeilzadeh-Salestani .

Diagnosis.

Separated from the vascular plant-associated species and algae-associated species of Olpidium s. stricto based on reticulate to spiky ornamentation in resting spores instead of star-like shapes. Nematovomyces spp. infect nematodes, rotifers, and their eggs. Distinguishable from other fungi based on diagnostic nucleotide signatures in SSU V 4 (positions 729–743 aaccgggtgtggcct in S. cerevisiae ; no mismatch allowed) and ITS 2 (positions 68–77 aacaatgtct in N. soinasteënsis; one mismatch allowed) and LSU D 2 (positions 679–698 in N. soinasteënsis and 595–614 in S. cerevisiae : gttgtctttgttattttcca; one mismatch allowed). Forms a monophyletic, least inclusive clade in Nematovomycetaceae, covering sequences OQ 702947, GQ 330624, OQ 702883, JN 054659, JN 054675, OQ 702805, EUK 1100016 , EUK 1107129 , EUK 1102228 , EUK 1204135 , EUK 1124398 , EUK 1124395 , EUK 1124396 , and EUK 1124397 (Figs 1 , 55 ).

Description.

Sporangia in the host cell singly or in rows, spherical or pyriform, 15–35 µm diam., with a smooth wall and curved exit tube. Zoospores spherical, 2.5–3.5 µm diam, with one posterior flagellum. Flagellum arched near the insertion point to the zoospore body. Thallus produces a single evacuation tube that leaves a narrow exit tube. Resting spores spherical or oblong, with surface ornamented by delicate reticular pattern or linear or branched spines, arranged in chains outside the animal cuticle or in culture. Infects nematodes, rotifers, and their eggs internally.

Notes.

Includes species parasitizing on nematodes, rotifers, and their eggs. Comprises about 50 potential species represented by sequences OQ 702947 (peatland rotifer in MI, USA), GQ 330624 (peatland water in Switzerland), OQ 702883 (rotifer egg in lake water in ONT, Canada), JN 054659 (activated sludge in NSW, Australia), JN 054675 (activated sludge in Canada), EUK 1100016 (permafrost in Canada), EUK 1107129 (lake water in Sweden), EUK 1102228 (forest soil in Puerto Rico), EUK 1204135 (lake sediment in Lithuania), EUK 1124398 (forest soil in Estonia), EUK 1124395 (grassland soil in Estonia), and EUK 1200775 (forest soil in Italy).

Figures

Figure 1. Maximum Likelihood SSU- 5.8 S-LSU phylogram indicating placement of novel lineages in the fungal kingdom as highlighted in a coloured shade and red font. Previously described taxonomic clades are collapsed. All branches of Sumavosporidiomycetes and Gelotisporidiomycetes are shortened two-fold. Poorly supported branches with bootstrap values below 95 % / 99 % are indicated in blue. The original tree with bootstrap values and uncollapsed branches is indicated in Suppl. material 1.

Figure 55. Maximum Likelihood SSU- ITS - LSU phylogram indicating the position of Nematovomyces vermicola and N. soinasteënsis within Nematovomycota, with ultra-rapid bootstrap values indicated. Other genus-level groups are collapsed. Entomophthoromycota spp. were used as an outgroup.