Waitukubulimyces cliftonii Tedersoo, 2025

Tedersoo, Leho, Hosseyni Moghadam, Mahdieh S., Panksep, Kristel, Prins, Victoria, Anslan, Sten, Mikryukov, Vladimir, Bahram, Mohammad, Abarenkov, Kessy, Kõljalg, Urmas, Esmaeilzadeh-Salestani, Keyvan, Pawłowska, Julia, Wurzbacher, Christian, Ding, Yi, Alkahtani, Saad Hussin & Nilsson, R. Henrik, 2025, Thirty novel fungal lineages: formal description based on environmental samples and DNA, MycoKeys 124, pp. 1-121 : 1-121

Waitukubulimyces cliftonii Tedersoo sp. nov.

Diagnosis.

Separation from other species of Waitukubulimyces based on ITS 1 (positions 59–78 actgtgaaattgctctggta; one mismatch allowed) and LSU (positions 470–489 tttttgtttgatgagtagag; one mismatch allowed) as indicated in Fig. 60 . Intraspecific variation up to 5.3 % in ITS 1. Interspecific distance> 20 % in ITS 1.

Type.

Vouchered soil sample TUE 002020 ( holotype); eDNA sequence EUK 1186291 = OZ 253816 ( legitype); eDNA sample TUE 102020 ( nucleotype); GSMc plot G 5043, tropical rainforest in Bellevue Chopin , Dominica, 15.2567, –61.3428 °E .

Description.

Other sequences: MK 718926 and MK 718947 (both: barren soil in CO, USA); GlobalFungi records 3 c 686302 c 6 bfd 00 ff 4 db 5 b 414 d 28 c 645 ( woodland soil in Marina, CA, USA, 36.6849, – 121.7780°E); 4 d 070 bd 97 b 6 d 68091 a 85749 c 15 e 6 c 744 (forest soil in Soria, Spain, 41.8694, – 2.87528°E); 61 c 43 b 4 d 22 e 1 a 0 efa 38 d 2 dba 3311970 e (cropland soil in Hangle, Uyghuria, China, 46.1886°N, 83.3294°E); 90 b 3386 fc 8 d 47 acc 87 e 18126 f 1 c 5 e 50 b (near-glacier soil in Arikaree, CO, USA); and abb 8924 cf 48 b 17 d 892 b 88816 e 96 f 0 ff 0 (grassland soil in Yahelong Gongma, Tibet, 38.21°N, 98.16°E).

Etymology.

> Waitukubuli> (Igneri) refers to the country of Dominica, where the type material was collected, and Clifton refers to Clifton P. Bueno de Mesquita, who collected the first material of this species ( MK 718926 and MK 718947; Bueno de Mesquita et al. 2020).

Notes.

Recorded from soil in three localities in Dominica and the USA. The 11 additional GlobalFungi records supplement findings from soil in various habitats in Spain, China, Tunisia, and the USA. ITS 1 was used in molecular diagnosis instead of ITS 2 because only a single sequence was available for ITS 2.

Figures

Figure 60. Diagnostic nucleotide sequences of Waitukubulimyces cliftonii relative to the closest related species in ITS 2 and LSU. Numbers indicate positions in the legitype (marked with an asterisk).