Phaenoglyphis xanthochroa Förster, 1869

Vogel, Jonathan, Peters, Ralph S., Selfa, Jesús & Ferrer-Suay, Mar, 2024, Characterising the north-western European species of Phaenoglyphis Förster, 1869 (Hymenoptera: Figitidae: Charipinae) with novel insights from DNA barcode data, Biodiversity Data Journal 12, pp. e 120950-e 120950 : e120950-

Phaenoglyphis xanthochroa Förster, 1869

Materials

Type status: Other material. Occurrence: recordedBy: GBOL III; individualCount: 1; sex: female; disposition: in collection; occurrenceID: F7C172B0-1FB9-5483-8FBB-7BFC0D8FCAD5; Taxon: family: Figitidae ; genus: Phaenoglyphis ; specificEpithet: xanthochroa ; scientificNameAuthorship: Förster, 1869; Location: country: Germany; countryCode: DE; stateProvince: Hesse; municipality: Waldeck-Frankenberg; locality: National park Kellerwald-Edersee, Banfehaus ; verbatimElevation: 265 m; decimalLatitude: 51.167; decimalLongitude: 8.9749; Identification: identifiedBy: Mar Ferrer-Suay; dateIdentified: 2023; Event: eventID: 1078; samplingProtocol: Malaise trap (Krefeld type); eventDate: 2021-7 / 8 - 22 / 5; year: 1869; habitat: old floodplain of the Banfe; Record Level: language: en; institutionID: ZFMK; collectionID: ZFMK-TIS- 2632857; basisOfRecord: PreservedSpecimen

Type status: Other material. Occurrence: recordedBy: GBOL III; individualCount: 1; sex: female; disposition: in collection; occurrenceID: BEA0E06B-AE5C-5D91-83C0-77F79133F67B; Taxon: family: Figitidae ; genus: Phaenoglyphis ; specificEpithet: xanthochroa ; scientificNameAuthorship: Förster, 1869; Location: country: Germany; countryCode: DE; stateProvince: Hesse; municipality: Waldeck-Frankenberg; locality: National park Kellerwald-Edersee, Maierwiesen ; verbatimElevation: 365 m; decimalLatitude: 51.1555; decimalLongitude: 9.0015; Identification: identifiedBy: Mar Ferrer-Suay; dateIdentified: 2023; Event: eventID: 1033; samplingProtocol: Malaise trap (Krefeld type); eventDate: 2021-6 / 7 - 22 / 8; year: 1869; Record Level: language: en; institutionID: ZFMK; collectionID: ZFMK-TIS- 2641256; basisOfRecord: PreservedSpecimen

Diagnosis

Phaenoglyphis xanthochroa is easily differentiated from the other Phaenoglyphis species by its dark yellow body and deeply excavated notauli (Fig. 4 g).

Molecular characterisation

Maximum barcode-distance within species: 2.3 % (2).

Minimum barcode-distance to closest species: 10.7 % ( P. villosa ).

Consensus barcode sequence (652 bp):

5 ’ - GATTTTATATTTTATTTTTGGGATTTGGTCAGGAATAATTGGCTCAGCTTTAAGAATAATTATTCGAATAGAATTAGGAACCCCTTCTCAATTGATTGGTAATGATCAAATTTATAATTCAATTGTAACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCAATTATAGTAGGTGGGTTTGGGAATTATTTAATTCCTTTAATATTATCAGCCCCTGATATAGCTTTCCCACGTTTAAATAATATAAGATTTTGGTTATTAATCCCAGCTTTATTTCTATTAATTATAAGAATATTTATTGATCAAGGGGCAGGGACTGGATGAACTGTTTACCCTCCTTTATCTTCAAATTTAGGTCATTCTGGGATTTCTGTTGATTTAACAATTTTTTCACTTCATTTAAGAGGAGTATCTTCAATTTTAGGGGCAATTAATTTTATTTCAACAATTTTAAATATACGAATTATTARAATAGATAAAATTTCATTATTTATTTGATCAATTTTTTTAACAACAATTTTATTATTATTGTCTTTACCTGTTTTAGCTGGAGGTATTACTATATTATTATTTGATCGAAATTTAAATACTTCTTTTTTTGACCCTATAGGAGGAGGAGACCCAATTTTATACCAACATTTATTT- 3 ’

Distribution

Austria, Czech Republic, Finland, France, Germany, Ireland, Poland, Sweden, Switzerland, The Netherlands, and United Kingdom: England ( Ferrer-Suay et al. 2023).

Taxon discussion

The sequence with the BOLD-ID AMTPB 279-15 has an associated photograph uploaded on BOLD. The specimen shown exhibits the unique morphology of P. xanthochroa and the identity is further confirmed by an expert hymenopterist. These circumstances led us to include the specimen into the molecular characterisation of the species. Phaenoglyphis xanthochroa is so unique in morphology and shows a large distance to the barcode sequences of other Phaenoglyphis species that it leaves room for debate whether to put this species in its own genus. We refrain from doing so as we think that a more thorough molecular dataset needs to back up this decision and the practical use of a monotypic genus is very limited.

Figures

Figure 4. SEM images of Phaenoglyphis mesoscutum (dorsal view; all images show corresponding holotypes): a P. belizini; b P. evenhuisi; c P. longicornis; d P. salicis; e P. stricta; f P. villosa; g P. xanthochroa. Images are taken from Ferrer-Suay et al. (2019).