Amauropelma phangnga S. Li & Yao, 2022

Chu, Chang, Lu, Ying, Li, Shuqiang & Yao, Zhiyuan, 2022, Taxonomic notes on eleven species of the subfamily Cteninae (Araneae, Ctenidae) from Asia, Biodiversity Data Journal 10, pp. 96003-96003 : 96003

Amauropelma phangnga S. Li & Yao sp. n.

Materials

Type status: Holotype. Occurrence: recordedBy: Z. Chen; individualCount: 1; sex: male; lifeStage: adult; Taxon: order: Araneae; family: Ctenidae ; genus: Amauropelma ; Location : country: Thailand; stateProvince: Phang Nga; verbatimLocality: Mueang District , Tapan Cave ; verbatimElevation: 35 m a.s.l.; verbatimLatitude: 8°27.305'N; verbatimLongitude: 98°31.690'E; Event: year: 2015; month: 10; day: 10; Record Level: institutionCode: IZCAS-Ar 43531 Type status: Paratype. Occurrence: recordedBy: Z. Chen; individualCount: 1; sex: male; lifeStage: adult; Taxon: order: Araneae; family: Ctenidae ; genus: Amauropelma ; Location : country: Thailand; stateProvince: Phang Nga; verbatimLocality: Mueang District , Tapan Cave ; verbatimElevation: 35 m a.s.l.; verbatimLatitude: 8°27.305'N; verbatimLongitude: 98°31.690'E; Event: year: 2015; month: 10; day: 10; Record Level: institutionCode: IZCAS-Ar 43532

Description

Male (IZCAS-Ar 43531): PL 3.3, PW 2.8, AW 1.2, OL 3.0, OW 1.9. Eye diameters and interdistances: AME 0.09, ALE 0.12, PME 0.10, PLE 0.10, AME-AME 0.04, AME-ALE 0.13, PME-PME 0.08, PME-PLE 0.21, AME-PME 0.05, ALE-PLE 0.08, clypeus AME 0.17, clypeus ALE 0.22. Palp and leg measurements: palp 3.8 (0.9, 0.6, 0.8, -, 1.5), I 13.5 (3.3, 1.6, 3.7, 3.2, 1.7), II 11.6 (3.1, 1.6, 3.0, 2.6, 1.3), III 10.9 (2.9, 1.4, 2.7, 2.6, 1.3), IV 14.8 (3.5, 1.5, 3.9, 4.2, 1.7). Leg formula 4123. Spination of palp and legs: palp 131, 100, 1101; femora I p021, d211, r112, II-III p012, d111, r012, IV p102, d111, r012; patellae I-IV 001; tibiae I p010, v22222, II p100, r100, v22222, III p11, d111, r11, v222, IV p11, d11, r11, v222; metatarsi I v222, II p112, r010, v222, III p112, d010, r112, v222, IV p112, r112, v2222. Chelicerae with 3 promarginal, 4 retromarginal teeth, without denticles. Retromargin of chelicerae close to fang base without bristle. Tarsi and metatarsi without scopula. Claw tufts arising separately, but intermingle with each other distally. Leg claws I with 7 and II with 6 secondary teeth. Position of tarsal organ: I 1.37, II 0.92, III 0.85.

Palp (Fig. 4 a-c). Patella with distinct retrolateral apophysis. RTA protruding at an almost right angle from tibia in ventral view, with broad base and two short apices, both dorso-distad. Cymbium tip conical, with prolatero-proximal outgrowth. Embolus (Fig. 9 a) arising at 8 o’clock position, its tip with an extension. Conductor arising at 3 o’clock position, long and laminar, running around tegulum anti-clockwise, its tip situated subdistally. Tegular apophysis arising subcentrally, strongly concave on ventral side and distinctly excavated on prolateral side.

Colour (Fig. 5 a and b). Yellowish-brown. Dorsal prosoma with eyes marked with black rings, fovea distinct, reddish-brown. Ventral opisthosoma grey.

Female

Unknown.

Variation: Paratype male (IZCAS-Ar 43532): PL 3.4, OL 2.4.

Diagnosis

Small Ctenidae (total length male 5.8-6.3). The new species can be distinguished from all known congeners by the embolus tip with an extension (Fig. 4 b and Fig. 9 a), by the tegular apophysis strongly concave on ventral side and distinctly excavated on prolateral side (Fig. 4 a and b), by the conductor arising at 3 o’clock position, long and laminar, running around tegulum anti-clockwise, its tip situated subdistally (Fig. 4 b), by the RTA protruding at an almost right angle from tibia in ventral view, with broad base and two short apices, both dorso-distad (Fig. 4 b) and by the patella with distinct retrolateral apophysis, pointing anteriorly (Fig. 4 b). This species can also be distinguished from Am. krabi sp. n. by the COI p-distance 0.134 between them.

Etymology

The specific name refers to the type locality and is a noun in apposition.

Distribution

Thailand (Phang Nga, type locality; Fig. 1 ).

DNA Barcode

Male (IZCAS-Ar 43532):

GGTGGGTTCGGAAATTGATTGGTTCCTTTGATGTTAGGAGCTCCTGATATATCATTTCCTCGTATAAATAATTTGTCTTTTTGGTTACTTCCTCCTTCTTTATTTTTGTTATTAATATCTTCTATGGTGGAAATAGGAGTGGGAGCAGGATGAACTGTCTATCCTCCTTTAGCTTCTAGAATAGGGCATGTGGGAAGATCAATAGATTTTGCGATTTTTTCTCTTCATTTAGCTGGAGTTTCTTCTATTATGGGAGCGGTTAATTTTATTTCTACTATTATTAATATGCGATTATATGGAATAACTATAGAAAAGGTTCCTTTATTCGTTTGATCAGTTTTTATTACTGCAGTTTTGTTGTTGTTATCATTACCTGTGTTAGCAGGTGCTATTACTATATTATTGACAGATCGAAATTTTAATACTTCTTTTTTTGATCCTGCAGGGGGTGGAGATCCAATTTTATTTCAACATTTATTCTGATTTTTTGGTCACCCTGGAAAGTTTAA (GenBank accession number OP718556).

Figures

Figure 1. Distribution records of ctenid spiders from Asia in this study. 1. Amauropelma krabi sp. n.; 2. Am. phangnga sp. n.; 3. Am. saraburi sp. n.; 4. Anahita medog sp. n.; 5. An. popa; 6. Bowie fascination; 7. B. ninhbinh sp. n.; 8. B. vinhphuc sp. n.; 9. B. borneo sp. n.; 10. B. engkilili sp. n.; 11. B. sabah sp. n.

Figure 4. Amauropelma phangnga sp. n., palp, holotype. a: Prolateral view; b: Ventral view; c: Retrolateral view. C = conductor, E = embolus, PCO = prolatero-proximal cymbial outgrowth, RPA = retrolateral patellar apophysis, RTA = retrolateral tibial apophysis, TA = tegular apophysis. Scale bar: 0.5 mm (a-c).

Figure 5. Amauropelma phangnga sp. n., habitus, holotype male. a: Dorsal view; b: Ventral view. Scale bar: 1.0 mm (a, b).