Parasabella crassichaetae, Capa & Murray, 2015

Capa, María & Murray, Anna, 2015, Integrative taxonomy of Parasabella and Sabellomma (Sabellidae: Annelida) from Australia: description of new species, indication of cryptic diversity, and translocation of some species out of their natural distribution range, Zoological Journal of the Linnean Society 175 (4), pp. 764-811 : 787-791

PARASABELLA CRASSICHAETAE SP. NOV. COMPLEX

( FIGS 4E , 5E, R–T, 12 , 13 )

Holotype: AM W.47145, New South Wales, Shellharbour, north-east of Bass Point, ‘ The Humps’ , 34°35′35″S, 150°54′22″E, from orange sponge, 22.4 m depth, 4.v.2010, coll. R. T. Springthorpe, MI NSW 3956.

Paratypes: AM W.47146 (6), same collection details as holotype .

Additional material examined (see Appendix for details): Australia. Western Australia: Esperance (three), Albany (four), Outer Bunbury Harbour (two), Ningaloo Reef (many), Dampier Archipelago (nine) ; Northern Territory: Darwin Harbour (two); Queensland: Weipa (six), Cairns (six) ; New South Wales: Cook Islands (four), Byron Bay (two), Solitary Islands (eight), Coffs Harbour (two), Port Stephens (11), Port Jackson (12), Botany Bay area (16, including PS21, PS23, PS24, PS28), Shellharbour (one = PS03), Jervis Bay (one), Batemans Bay (six) . USA. Hawaii: Oahu, Coconut Island (eight, including PS10, PS11, PS12) .

Comparative material examined: Holotype of Demonax leucaspis Kinberg, 1867 , SMNH 575, Peru, east of Lima, San Lorenzo Island, 12°00′S, 077°00′W, collected by Eugenie Expedition 1851–1853, station 568–9. Holotype of Sabella albicans Johansson, 1922 , UPSZTY 2304, Japan, Misaki, ‘Diver’ from Laminaria, S. Bock collection.

Diagnosis: Radiolar eyes absent. Radioles supported by 6–10 rows of vacuolated cells near base. Thoracic ventral shields in contact with neuropodial tori. Inferior thoracic notochaetae type A, with hoods three times as wide as shaft, and up to three times as long as its maximum width. Thoracic uncini with mediumlength handles, and neck half of breast length.

Description: Body 12.5 mm long, 1.7 mm wide; crown 4 mm long; Thorax with six chaetigers, and abdomen with 63, posterior end regenerating. Preserved holotype lacks colour on trunk, but diffuse brown pigmentation is present on collar, and crown has four pigment bands with radiolar pinnules also pigmented, as well as brown pigment spots groups of bars along radioles. Radiolar crown basal lobes as long as 1.5 times thoracic chaetigers, with nine pairs of radioles arranged in two semicircles. Radioles with outer margins quadrangular to round in cross-section ( Fig. 13A, D ) and each supported basally by eight vacuolated cells ( Fig. 4E ). Radiolar tips wide, tapering, bare for approximately twice length of longest pinnules (or equal to length of four thoracic segments). Radiolar flanges and eyes absent. Dorsal lips with radiolar appendages as long as five thoracic segments, each with single pinnular appendage. Posterior peristomial ring collar similar in length all around, completely covering base of crown, with rounded ventral lappets shorter than one thoracic segment ( Fig. 13A, B ) and rounded dorsal margins. Peristomial eyes present subdermally. Anterodorsal fleshy swelling absent. Thoracic ventral shields similar in length, twice as wide as long, in contact with thoracic tori. First ventral shield with slight incision in anterior margin and m-shaped. Collar chaetae elongate, narrowly hooded ( Fig. 13E ). Superior thoracic notochaetae elongate narrowly hooded ( Fig. 13F ); inferior thoracic chaetae broadly hooded (type A), and hood three times width of shaft and about three times as long as its maximum width ( Figs 5E, 13F, G ). Thoracic uncini with eight to ten rows of teeth over main fang, covering slightly over half length of main fang ( Fig. 13H ), with well-developed breast, reaching to the tip of main fang, neck half length of breast, and handle 1.5–2 times length of the distance between breast and main fang ( Fig. 5R). Thoracic neuropodial companion chaetae with subdistal end enlarged, conspicuous microtubercles forming hood resulting in dentate appearance, and with thin distal mucro, compressed laterally ( Fig. 13I ). Abdominal neurochaetae narrowly hooded ( Fig. 13J ). Abdominal uncini with about eight rows of teeth over main fang, covering half length of main fang ( Fig. 13K ), neck shorter than breast, breast well developed and with medium-length handle, 1.5 times length of the distance between main fang and breast ( Fig. 5S). Pygidium a rim with a ventral anus ( Fig. 13L ), several red eyespots on both sides.

Variation: Specimens display variability for many features: size (4–22 mm length, 0.5–1.8 mm width), numbers of thoracic chaetigers (4–8), abdominal segments (ten to 63), number of radioles (5–12), and numbers of rows of vacuolated cells supporting radioles basally (six to ten). Dorsal radiolar appendages vary from 4–8 thoracic segments in length; pinnular appendages vary from 0–2 pairs. Collar completely covers base of crown in some specimens, but junction of peristomium and crown is laterally visible in some small specimens. Thoracic uncini vary in shape with handles one to two times length of the distance between breast and main fang, and 8–10 rows of teeth over main fang. Abdominal uncini have 6–10 rows of teeth over main fang and short- to medium-length handles (0.5–1.5 times length of the distance between main fang and breast; Fig. 5S, T). There is not much variability, however, in the shape of inferior thoracic chaetae – their width varies from 2–3 times width of shaft and three times as long as its maximum width. Some of this morphological variability is summarized in Table 5. Preserved specimens vary from possessing little colour pigment in radioles (a few spots) to three to four pigment bands in crown, with pigmented radiolar pinnules, and longitudinal bars of pigment embedded in rachis of radioles ( Fig. 12A–C ). Pygidial eyespots faded in some specimens. Tubes are tough and chitinous, with adherent sand particles, shell, and bryozoans.

Reproductive features: Some specimens as small as 8 mm in body length contain eggs in abdominal segments.

Genetic data: Within the definition of P. crassichaetae sp. nov. two subclades, well supported and significantly different, were recovered ( Fig. 3B, C ). The same haplotype was found for Australian specimens and a single mitochondrialsequence obtained from Hawaiian populations. Comparisons of nuclear fragments showed that divergence between clades is up to 10.6% ( Table 4). One clade comprises specimens from Hawaii, Morphological features Distribution Specimens (Registration numbers)

Abdominal uncini with WA NMVF108905*, NMVF108908*, AM W.21996, AM W.47144*, medium handle and around AM W.47148–9 ten rows of small teeth QLD AM W.36448*, AM W.4392, AM W.47178–80, AM W.47151 above main fang NSW AM W.47181*, AM W.31102, AM W.46677, AM W.31103 AM W.37028 (PS03), AM W.37044 (PS21), W.37046 (PS23), W.37047 (PS24), W.37049 (PS28) Hawaii AM W.37036 (PS12), AM W47183

Abdominal uncini with short WA NMVF108906, AM W.36447, AM W.47150 handle and six to seven NT AM W.32579 (PS16), AM W.47147 rows of larger teeth above Hawaii AM W.37034 (PS10), AM W.37035 (PS11), AM W.37037 (PS13) main fang

*Specimens with six to eight rows of vacuolated cells supporting the radioles basally.

NSW, New South Wales; QLD, Queensland ; NT, Northern Territory; WA, Western Australia.

New South Wales, and the Northern Territory that differ by a maximum of 6.0% of their ITS sequences (New South Wales and Northern Territory specimens, not shown). Specimens belonging to this clade are characterized by sharing several diagnostic nucleotide blocks such as CTACCCCCTGT in the 334–344 nucleotide positions and the ATCTGCTCTGGGCGGTCCT in the 586– 584 nucleotide positions of the ITS alignment. The second clade, consisting of five specimens from three close localities in New South Wales, with only ITS fragments successfully sequenced, had the same haplotype with unique blocks, such as CTTCACTCTACCCCCTGT in the 327–377 nucleotide positions, ACGTCTGCCGGAC in the 356–368 nucleotide positions, and TGCAAGGAC CCGCCCCACATCTGCTCTGGGCGGTCCTCCTT in the 548–588 nucleotide positions in the ITS alignment.

Remarks: Parasabella crassichaetae sp. nov. complex is characterized by exceptionally broad and short inferior thoracic chaetae with a thin distal tip, almost resembling paleae externally but with a shaft continuing through the hood and into the distal tip, a character that defines broadly hooded chaetae. This attribute is also shared by other congeneric species such as P. albicans , P. leucaspis , Parasabella langerhansi , Parasabella brevithoracica ( Pillai, 1961) , Parasabella pallida Moore, 1923 , Parasabella saxicola ( Grube, 1861) , P. media , Parasabella tenuicollaris , P. tommasi , and Parasabella torulis ( Table 2). Parasabella torulis is distinguished from the others by possessing thoracic ventral shields separated from neuropodial tori. All the other species have ventral shields in contact with neuropodial uncinial tori. Some of these species, such as P. media and P. leucaspis ( Claparède, 1870; Knight-Jones, 1983; Perkins, 1984; Giangrande, 1994), differ from P. crassichaetae sp. nov. by the presence of radioles with more than 20 vacuolated cells in the bases of radioles. Parasabella leucaspis also possesses much shorter dorsal lips, only as long as one thoracic chaetiger compared with lengths more than four chaetigers in P. crassichaetae sp. nov. Both P. media and P. leucaspis also display variability in the shape of the inferior thoracic chaetae ( Perkins, 1984), unlike P. crassichaetae sp. nov., which possesses only wide and short type A inferior thoracic chaetae.

Parasabella langerhansi is distinguished from P. crassichaetae sp. nov. by having only four rows of vacuolated cells supporting the radioles ( Knight-Jones, 1983). Of the remaining species having a similar number of vacuolated cells, P. tommasi possesses thoracic uncini with necks longer than breast and handles up to twice the length of distance between breast and main fang ( Giangrande, 1994), while in P. crassichaetae sp. nov. necks are half the length of the breast, and handle is as long as the distance between breast and main fang or slightly longer. Parasabella brevithoracica has thoracic uncini with both necks and handles shorter than the new species ( Knight-Jones, 1983; Table 2). Parasabella saxicola has longer inferior thoracic chaetae, and the thoracic uncini have shorter necks compared with P. crassichaetae sp. nov. ( Knight-Jones, 1983). Parasabella albicans differs from P. crassichaetae sp. nov. in the relative length of the neck and breast of the thoracic uncini ( Table 2; Johansson, 1922; Uchida, 1968) and a much shorter peristomial collar. Additionally, although we were unable to dissect thoracic inferior chaetae from the type specimen of P. albicans , these were reported by Imajima & Hartman (1964) as being ‘non-spatulate’, and ‘short, broadly limbate’ by Uchida (1968: 608, Fig. 11 ), suggesting that they are dissimilar to the very broad type A chaetae of P. crassichaetae sp. nov. The species sharing the most features with P. crassichaetae sp. nov. is therefore P. pallida ( Table 2). The differences between these species are the lengths of dorsal radiolar appendages, which are short in P. pallida ( Perkins, 1984: 313; Fig. 15F ) but as long as 4–8 thoracic chaetigers in P. crassichaetae sp. nov., as well as the apparent pigmentation pattern. Parasabella pallida was described without any pigment ( Moore, 1923), although Perkins (1984) described nontype material of P. pallida as having ‘faint, light brown color spots on radioles’ – a distinct difference compared with specimens of P. crassichaetae sp. nov., which typically show pigment in the radioles (either transverse bands, spots, or longitudinal bars).

Etymology: The name of the species refers to the broad inferior thoracic chaetae, a distinct trait when compared with other Australian congeners.

Type locality: Shellharbour, New South Wales, Australia.

Distribution: Around Australian coasts except Victoria and South Australia ( Fig. 1B ); Hawaii.

Ecological notes: Specimens have been found in tropical and temperate environments in dead coral rubble, sponges, algae, and artificial surfaces in ports and harbours, from the intertidal to 25 m depth.

Figures

Figure 1. Maps with collecting sites in Australia. A, Parasabella aberrans spp. complex, Parasabella sp. cf. Parasabella aulaconota, Parasabella bioculata sp. nov. B, Parasabella crassichaetae sp. nov. complex, Parasabella sp. cf. Parasabella japonica, Parasabella sp. cf. Parasabella rugosa, Sabellomma cupoculata sp. nov.

Figure 3. Maximum likelihood topologies. A, cytochrome oxidase 1 fragments. B, internal transcribed spacer fragment. C, combined data set. Bootstrap supports over 75% shown on nodes. Scale bar, average of nucleotide substitutions per site.

Figure 4. Cross-sections of radioles near the base showing the supporting cartilaginous vacuolated cells in the rachis (with grey nuclei), surrounded by an extracellular cartilaginous sheath (white) and covered by columnar epithelium (grey). Upper side of drawings are the outer margin of radioles; on the bottom incomplete pinnules are sketched with a blood vessel (black) in between. A, Parasabella aberrans spp. complex. B, Parasabella sp. cf. Parasabella aulaconota. C, Parasabella fullo. D, Parasabella bioculata sp. nov. E, Parasabella crassichaetae sp. nov. complex. F, Parasabella sp. cf. Parasabella japonica. G, Parasabella sp. cf. Parasabella rugosa. H, Sabellomma cupoculata sp. nov. A, AM W.36947; B, AMW.47009; C, ZMB 5731; D, AM W.46840; E, AM W.47181; F, AM W.36450; G, AM W.36431; H, AM W.47189.

Figure 11. Parasabella bioculata sp. nov. scanning electron microscope photographs. A, anterior thoracic chaetigers and base of radiolar crown, ventral view, showing ventral shields separated from neuropodial tori. B, same, lateral view. C, same, dorsal view. D, inside of radiolar crown, frontal view, showing dorsal lips and long radiolar appendages. E, elongate, narrowly hooded collar chaetae. F, midthoracic chaetiger, elongate, narrowly hooded superior thoracic chaetae, and inferior, broadly hooded type B chaetae. G, thoracic uncini. H, companion chaetae. I, midabdominal, narrowly hooded neurochaetae. J, abdominal uncini. A–J, AM W.36449.

Figure 12. Parasabella crassichaetae sp. nov. complex, colour micrographs of preserved specimens. A, whole specimen, lateral view. B, anterior chaetigers, showing the base of crown and the collar margins. C, specimens with detached crown showing the peristomial eyes (arrows) near the insertion site of the radiolar lobes. A–B, AM W.31103; C, AM W.37028.

Figure 13. Parasabella crassichaetae sp. nov. complex, scanning electron microscope photographs. A, anterior thoracic chaetigers and base of radiolar crown, ventral view, showing ventral shields in contact with neuropodial tori, and ventral lappets. B, anterior chaetigers, ventral view, of specimens with crown removed. C, anterior body, lateral view. D, same, dorsal view. E, elongate narrowly hooded collar chaetae. F, midthoracic parapodium, elongate, narrowly hooded superior chaetae (arrow) and broadly hooded type A chaetae in inferior group. G, detail of inferior, broadly hooded type A chaetae. H, thoracic uncini. I, companion chaetae. J, midabdominal, narrowly hooded neurochaetae. K, abdominal uncini. L, posterior abdominal chaetigers and rim-like pygidium. A, C, D, E, L, AM W.36298; B, F–K, AM W.31103.

Figure 15. Parasabella sp. cf. Parasabella japonica, scanning electron microscope photographs. A, anterior thoracic chaetigers and base of radiolar crown, ventral view, showing ventral shields separated from neuropodial tori, and ventral lappets. B, anterior chaetigers, lateral view. C, same, dorsal view. D, midthoracic parapodium, elongate, narrowly hooded superi- or chaetae and broadly hooded type B chaetae in inferior group. E, detail of inferior, broadly hooded type B chaeta. F, thoracic uncini and companion chaetae. G, thoracic uncini, detail. H, companion chaetae showing the laterally compressed hood. I, midabdominal narrowly hooded neurochaetae. J, abdominal uncini. A–J, AM W.36450.