Savannolpidiomycetes Tedersoo & Esmaeilzadeh-Salestani

Tedersoo, Leho, Hosseyni Moghadam, Mahdieh S., Panksep, Kristel, Prins, Victoria, Anslan, Sten, Mikryukov, Vladimir, Bahram, Mohammad, Abarenkov, Kessy, Kõljalg, Urmas, Esmaeilzadeh-Salestani, Keyvan, Pawłowska, Julia, Wurzbacher, Christian, Ding, Yi, Alkahtani, Saad Hussin & Nilsson, R. Henrik, 2025, Thirty novel fungal lineages: formal description based on environmental samples and DNA, MycoKeys 124, pp. 1-121 : 1-121

Savannolpidiomycetes Tedersoo & Esmaeilzadeh-Salestani class. nov.

Type order.

Savannolpidiales Tedersoo & Esmaeilzadeh-Salestani .

Diagnosis.

Distinguishable from other fungi based on diagnostic nucleotide signatures in SSU V 8 (positions 1546–1565 in S. cerevisiae gagcattgcaactattgctc; one mismatch allowed) and LSU D 2 (positions 525–534 in the type species and 472–481 in S. cerevisiae gtgcactttt; one mismatch allowed). Forms a monophyletic, least inclusive clade in Olpidiomycota, covering sequences EUK 1191172 , EUK 1191209 , EUK 1191210 , EUK 0534704 , EUK 1701673 , EUK 1701672 , EUK 1124874 , and EUK 1124875 (Fig. 1 ).

Notes.

Recognized based on eDNA sequences only. Encoded as clade GS 93 J in EUKARYOME v 1.9. Currently harbors Savannolpidiales (ord. nov.) and potentially an order-level group represented by sequence EUK 1191172 (forest soil in Taiwan). Comprises potentially 50–70 species, which are difficult to delimit because of multiple indels rather than substitutions in the ITS region and no clear barcoding gap. Detected in soil (94.8 % out of the 191 records) and sediments (5.2 %) in tundra to hot tropical biomes across all continents except Antarctica. Relatively common in Europe (51.8 % of records) but less common in tropical biomes (15.7 %).

Figures

Figure 1. Maximum Likelihood SSU- 5.8 S-LSU phylogram indicating placement of novel lineages in the fungal kingdom as highlighted in a coloured shade and red font. Previously described taxonomic clades are collapsed. All branches of Sumavosporidiomycetes and Gelotisporidiomycetes are shortened two-fold. Poorly supported branches with bootstrap values below 95 % / 99 % are indicated in blue. The original tree with bootstrap values and uncollapsed branches is indicated in Suppl. material 1.