Heliopetes elonmuski Grishin, 2023

Zhang, Jing, Cong, Qian & Grishin, Nick V., 2023, Thirteen new species of butterflies (Lepidoptera: Hesperiidae) from Texas, Insecta Mundi 2023 (969), pp. 1-58 : 40-42

Heliopetes elonmuski Grishin , new species

https://zoobank.org/ 93636723-E1FE-4D3E-9A3D-5F2CC96141E5

( Fig. 39 part, 40, 41a–c, 42)

Definition and diagnosis. Genomic analysis reveals that Heliopetes arsalte ( Linnaeus,1758) (type locality “Indiis”, Honey and Scoble (2001) suggested “South America, probably the Guianas”) is not monophyletic in both nuclear and mitochondrial genome trees ( Fig 39 blue and red), and instead northern populations identified as H. arsalte ( Fig 39 red) are sister to Heliopetes marginata Hayward, 1940 (type locality Ecuador: Balzapamba) ( Fig 39 green). The three clades are well-differentiated genetically: Fst / Gmin statistics for their comparison are 0.39/0.007, and therefore represent three distinct species. Searching for possible names that may apply to the northern populations (red clade), we see that Pyrgus figara Butler, 1870 was not definitively assigned to a particular locality. Butler (1870) wrote about the species he described in the publication that proposed the name figara : “The greater part of these are in the Kaden collection, now in the possession of Mr. Herbert Druce; and many of the species are from Venezuela.” Indeed a syntype of Pyrgus figara Butler, 1870 , female in BMNH, is labeled from “Druce Coll. ex Kaden Coll.”, and although it lacks the locality label, it is consistent with phenotype of H. arsalte from Venezuela (or other South American countries) in that it is a dark specimen with heavy overscaling along hindwing veins, especially by the outer margin, and broader dark marginal border on forewing (covering distal third of the wing) than in any North American specimens we have seen. Forewing costal cell is completely brown, and in North American specimens it is either mostly white and if brown then with a white streak at the base and along costa ( Fig. 40 , 41b, c ). Therefore, this evidence suggests that P. figara is of South American, possibly Venezuelan, origin, and this name does not apply to the red clade ( Fig. 39 ), indeed being a synonym of H. arsalte . In the absence of other available name candidates ( Papilio niveus Cramer, 1775 is from Suriname and is quite similar to South American H. arsalte , both having very narrow dark borders on wings, typical for males from the Guianas), the red clade represents a new species. Curiously, the COI barcodes are 1.7% (11 bp) different between the new species and H. arsalte , despite not being monophyletic with it, but 2.1% (14 bp) different from its sister H. marginata . This is because the evolutionary rate in the mitogenome is slower in H. arsalte ( Fig. 39b blue) compared to the other two species ( Fig. 39b red and green). The new species keys to C.2.7(a) in Evans (1953) and differs from H. arsalte by male genitalia ( Fig. 42 ): the tegumen is longer, bulkier; the valva is narrower, the harpe is straighter, separated from the ampulla by a wide cleft, the phallobase is shorter; and by the dark form females ( Fig. 41c, d ) with narrower forewing dark border, especially towards tornus, and more extensive pale scales (sometimes a ray) in the forewing costal cell towards the wing base. Due to phenotypic differences being slight, best diagnosed by DNA. A combination of the following base pairs is diagnostic in nuclear genome: aly3766.1.5:G62C, aly 2379.11.15:G51A, aly16576.4.4:C143T, and aly274.30.2:T84C, and COI barcode: A160G, A181T, C367C(not T), T562A, and C610T.

Barcode sequence of the holotype. Sample NVG-7557, GenBank OP762111, 658 base pairs: AACTTTATATTTTATTTTTGGAATTTGAGCAGGAATAGTAGGTACTTCTTTAAGATTATTAATTCGAACTGAATTAGGAAATCCAGGAT CATTAATTGGAGATGATCAAATTTATAATACTATTGTTACAGCTCATGCTTTTATTATAATTTTCTTTATGGTAATACCAATTATAATTG GTGGATTTGGAAATTGATTAGTACCTTTAATATTAGGAGCCCCAGATATAGCATTTCCTCGTATAAATAATATAAGATTTTGACTTTTA CCTCCATCTTTAACATTATTAATTTCAAGAAGTGTAGTAGAAAACGGAGCAGGAACTGGTTGAACAGTTTACCCCCCTCTCTCAGCTA ATATTGCACATCAAGGTTCTTCTGTTGATTTAGCTATTTTTTCTTTACATTTAGCAGGAATTTCATCTATCTTAGGAGCTATTAATTTTA TTACAACTATTATTAATATACGTATTAGAAATATATCATTTGATCAAATACCTTTATTTGTATGAGCAGTAGGTATTACAGCTTTATTATTA TTATTATCATTACCTGTTTTAGCAGGTGCTATTACTATATTATTAACAGATCGAAATTTAAATACATCATTTTTTGATCCTGCAGGAGGA GGAGATCCTATTTTATATCAACATTTATTT

Type material. Holotype: ♀ deposited in the Texas A&M University Insect Collection, College Station , Texas, USA ( TAMU), illustrated in Fig. 40 , bears the following seven rectangular labels, six white: [ FIRST | UNITED STATES | RECORD 2 of 2],[TEXAS: | CAMERON CO. | Boca Chica], [coll. | 20-X-73 | W. W. McGuire], [HESPE- RIIDAE, | Pyrginae: | Heliopetes arsalte | ( Linnaeus, 1758) | ♂ det. R. O. Kendall | M. & B. No. 112], [DNA sample ID: | NVG-7557 | c/o Nick V. Grishin], [genitalia | NVG170107-13 | Nick V. Grishin], and one red [HOLOTYPE ♀ | Heliopetes | elonmuski Grishin ] . Paratypes: 6♂♂ and 2♀♀: 1♀ the same data as the holotype ; Mexico: Tamaulipas: 1♀ NVG-7559 Ciudad Mante, Los Arcos Ct. , 2-Jul-1977, R. O. Kendall and C. A. Kendall leg. [ TAMU], genitalia NVG170107-15 ; 1♂ NVG-20062H05 0.5 km SW of Gomez Farias , 400 m, 24-Dec-1972, C. J. Durden leg. [ TMMC] ; San Luis Potosi: 1♂ NVG-7558 ca. 10 mi E Cd. Valles, grounds Hotel Taninul , 5-Feb-1980, R. O. Kendall and C. A. Kendall leg. [ TAMU], genitalia NVG170107-14 ; 1♂ NVG-20062H08 Maiz , El Salto, 28-Jul-1981, C. J. Durden [ TMMC] ; Veracruz 1♂ NVG-19091C08, Boca del Rio , 9-Jun-1994, R. Segura leg. [ USNM] ; Guatemala 1♂ NVG-19091C09 Peten District, Finca Ixobel, S Poptun , 1700 ft, GPS 16.3039, −89.4222, 5-10-Jun-2003, Ron Leuschner leg. [ USNM] ; Honduras 1♂ NVG-19091C10 San Pedro Sula , Aug-1975, N. L. H. Krauss leg. [ USNM]. Type locality. USA: Texas, Cameron Co., Boca Chica .

Etymology. The name is inspired by the type locality. Boca Chica is now a site for SpaceX, a company founded by Elon Musk that opens unprecedented opportunities for the exploration of the unknown. It is our hope that nature of the Boca Chica area will be preserved, and genetically unique species like this one will thrive there and around the area. The name is a noun in the genitive case.

English name. SpaceX white-skipper.

Distribution. From South Texas to Costa Rica.

Figures

Figure 39. Trees of Heliopetes arsalte group constructed from protein-coding regions in a) nuclear and b) mitochondrial genomes: H. elonmuski sp. n. (red), previously regarded as conspecific with H. arsalte (blue), and H. marginata (green). The holotype is labeled in magenta. See Fig. 1 legend for other notations.

Figure 40. Holotype of Heliopetes elonmuski sp. n. dorsal (left) and ventral (right) views, data in text.

Figure 41. Two species ofHeliopetes, iNaturalist observations.a–c) Heliopetes elonmuski sp. n. a) in copula♀ (left), ♂ (right) 101984200 Mexico: Veracruz, vic. Huejutla de Reyes, 13-Nov-2021 © Eduardo Axel Recillas Bautista. b) ♂ 31651109 Belize: Crooked Tree, 29-Jul-2015 © shirdipam. c) ♀ 131414102 Mexico: Chiapas, Ocosingo, 18- Aug-2022 © Silvano LG.d) ♀ H. arsalte 117179611 Brazil: Paraiba, Pitimbu, 14-May-2022 © Thomaz de Carvalho Callado. Some images are color-corrected, rotated, and/or flipped. CC BY-NC 4.0 https://creativecommons.org/ licenses/by-nc/4.0/.

Figure 42. Male genitalia of Heliopetes. a–b) Paratype of H. elonmuski sp. n. NVG-20062H08 (data in text) in different views: a) left lateral, b) dorsal. c–d) H. arsalte NVG-20062H07 from Brazil: Rondônia, 6-8 km NE of Cacaulandia, 23-Apr-1992, C. J. Durden leg. [TMMC]: c) left lateral, d) dorsal.