Autochton caballo Grishin, 2023

Zhang, Jing, Cong, Qian & Grishin, Nick V., 2023, Thirteen new species of butterflies (Lepidoptera: Hesperiidae) from Texas, Insecta Mundi 2023 (969), pp. 1-58 : 27-29

publication ID	https://doi.org/ 10.5281/zenodo.7710103
persistent identifier	https://treatment.plazi.org/id/DD62E766-2A57-7262-FF36-C65AFCD1FBF7
treatment provided by	Felipe
scientific name	Autochton caballo Grishin
status	sp. nov.

Treatment

Autochton caballo Grishin , new species

https://zoobank.org/ A49A7A6F-99C4-4405-8A50-E689FEAE9538

( Fig. 21 View Figure 21 part, 22, 23a, b)

Definition and diagnosis. The Z chromosome tree reveals that in addition to Autochton reducta (Mabille and Boullet, 1919) (type locality in Venezuela) that we regard as a species ( Fig. 21 View Figure 21 green), a possible sister to Autochton potrillo (Lucas, 1857) (type locality in Cuba) ( Fig. 21 View Figure 21 blue), continental populations identified as A. potrillo form a clade of their own ( Fig. 21 View Figure 21 red) thus constitute a distinct taxon. Fst / Gmin statistics for comparing the red and the blue clades are 0.31/0.009, but their COI barcodes do not show distinction: 0.3% (2 bp), even less so than those of A. reducta . Due to nuclear genome differentiation, the red clade represents a species distinct from A. potrillo , and differs from it by having larger hyaline spots on forewing ( Fig. 22 View Figure 22 , 23a, b View Figure 23 ), the discal cell spot is more saddle- (or horseshoe-) shaped, not broken into two spots as in many insular A. potrillo specimens ( Fig. 23c, d View Figure 23 ) or much reduced as in A. reducta ( Fig. 23e View Figure 23 ), both upper and lower shoulders of the spot are better developed; yellow overscaling is less extensive than in both A. potrillo and A. reducta , and the wings have less pebbly appearance as a result. Due to phenotypic variation, reliable identification is achieved by DNA characters: a combination of the following base pairs is diagnostic in the nuclear genome: aly16576.3.5:C27T, aly291.18.6:C69T,

aly259.28.6:T123C, aly 2007.4.2:A90G, and aly345.8.16:T81C, and COI barcode: T100T(not C), T250T(not C), and T364T(not C).

Barcode sequence of the holotype. Sample NVG-15101G06, GenBank OP762106, 658 base pairs:

AACTTTATATTTTATTTTTGGAATTTGAGCAGGATTAGTAGGTACTTCTTTAAGCTTATTAATTCGAACTGAATTAGGAACTCCTGGAT CATTGATTGGTGATGATCAAATTTATAATACTATTGTAACAGCTCATGCTTTTATTATAATTTTCTTTATAGTAATACCTATTATAATTG GAGGATTTGGAAATTGATTAGTACCTTTAATATTAGGAGCACCTGACATAGCTTTCCCCCGTATAAACAATATAAGATTTTGATTATTA CCCCCATCCCTAACTCTTTTAATTTCTAGTAGTATTGTAGAAAATGGTGCTGGAACAGGATGAACTGTTTATCCTCCTCTTTCTTCTAA TATTGCTCACCAAGGAGCTTCAGTTGATTTAGCAATTTTTTCCCTTCATCTTGCAGGTATTTCTTCTATTCTTGGAGCCATTAATTTTA TTACAACAATTATTAATATACGTGTTAATAATTTATCATTTGACCAAATACCTCTTTTCGTTTGAGCTGTAGGAATTACAGCTCTTCTTC TTTTACTTTCTTTACCTGTTTTAGCTGGAGCTATTACTATATTATTAACAGATCGAAATTTAAATACCTCATTTTTTGATCCTGCAGGAG GAGGAGACCCAATTTTATATCAACATTTATTT

Type material. Holotype: ♂ deposited in the National Museum of Natural History , Smithsonian Institution , Washington, DC, USA ( USNM), illustrated in Fig. 22 View Figure 22 , bears the following three rectangular labels, two white: [Hidalgo Co., TEX. | 6 mi W of Hidalgo | 19/X/74 | - Wm McG.], [DNA sample ID: | NVG-15101G06 | c/o Nick V. Grishin], and one red [HOLOTYPE ♂ | Autochton | caballo Grishin ] . Paratypes: 3♂♂ and 2♀♀, in TAMU, collected by Roy O. Kendall and C. A. Kendall: USA 1♂ NVG-19013H09 Texas, Bexar Co., north of San Antonio near NE Preserve, 4-Apr-1959 ; Mexico: 1♀ NVG-19013H11 Nuevo Leon, Cola de Caballo , 23-Oct-1979 ; 1♂ NVG-19013H12 San Luis Potosi, EI Naranjo, 1-Mar-1976 ; 1♂ NVG-19013H10 Coahuila, Hwy 57 ca. 24 km ESE Saltillo at truck rest area, 15-Sep-1977 ; and in USNM 1♀ NVG-5715, 09-SRNP-57000 Costa Rica: Area de Conservación Guanacaste, Guanacaste Prov., Sector Mundo Nuevo , ex larva, eclosed on 29-Aug-2009, Mariano Pereira leg., genitalia NVG160214-76 .

Type locality. USA: Texas, Hidalgo Co., 6 mi W of Hidalgo.

Etymology. The name (horse in Spanish) is for the saddle- or horseshoe-shaped spot in the forewing discal cell in this sister of A. potrillo (foal), typically with a less developed spot. The name is a masculine noun in apposition.

English name. Caballo skipper.

Distribution. Continental species: from South Texas, USA to Costa Rica.

Epargyreus socus chota Evans, 1952 is a junior subjective synonym of Epargyreus clavicornis (Herrich-Schäffer, 1869)

Genomic sequencing of two syntypes of Eudamus clavicornis Herrich-Schäffer, 1869 (type locality from USA to Tropical America), in MFNB, reveals that they are closely clustered with Epargyreus socus chota Evans, 1952 (type locality in Trinidad) ( Fig. 24 View Figure 24 orange). Their COI barcodes are 100% identical and the specimens are phenotypically similar. Therefore, we propose that Epargyreus socus chota Evans, 1952 , new synonym, is a junior subjective synonym of Epargyreus clavicornis (Herrich-Schäffer, 1869) . The type locality of E. clavicornis may be in Venezuela because E. socus chota has been recorded from Trinidad and Venezuela, and we are not aware of many mid-18 th century specimens collected in Trinidad.