Bryolpidium mundanum Tedersoo, 2025

Tedersoo, Leho, Hosseyni Moghadam, Mahdieh S., Panksep, Kristel, Prins, Victoria, Anslan, Sten, Mikryukov, Vladimir, Bahram, Mohammad, Abarenkov, Kessy, Kõljalg, Urmas, Esmaeilzadeh-Salestani, Keyvan, Pawłowska, Julia, Wurzbacher, Christian, Ding, Yi, Alkahtani, Saad Hussin & Nilsson, R. Henrik, 2025, Thirty novel fungal lineages: formal description based on environmental samples and DNA, MycoKeys 124, pp. 1-121 : 1-121

Bryolpidium mundanum Tedersoo sp. nov.

Diagnosis.

Separation from other species of Bryolpidium based on ITS 2 (positions 226–245 ctgaaaacaattcgagtgat; no mismatch allowed) and LSU (positions 465–494 gacggggctctcgctcgtga; no mismatch allowed) as indicated in Fig. 38 . Intraspecific variation up to 4.4 % in ITS 2. Interspecific distance> 20 % in ITS 2.

Type.

Vouchered soil sample TUE 028510 ( holotype); eDNA sequence EUK 1124873 = OZ 253805 ( legitype); eDNA sample TUE 128510 ( nucleotype); GSMc plot G 5911, wasteland soil in Tartu, Estonia, 58.3809°N, 26.6917°E .

Description.

Other sequences: EUK 0530197 ( GSMc plot G 6091, subtropical desert soil in Al Zita, Saudi Arabia, 28.9243°N, 35.4438°E); EUK 0530198 (urban park soil in Mildura, VIC, Australia, – 34.1854°N, 142.1696°E); EUK 0649726 (urban soil in Põlva, Estonia, 58.0666°N, 27.0939°E); and GlobalFungi records d 4847020 b 222 e 5 b 7830540 d 220 e 20499 (subtropical woodland soil in El Tepeyac, San Luis Potosi, Mexico, 57.7165°N, 27.0549°E); 32232805 aef 1 d 4510876 e 11 cba 753 f 7 d (temperate shrubland soil in Elche, Spain, 38.30, – 0.72); and 156 ae 55 aafdd 258247 d 24 e 567 a 23 cdf 3 (temperate forest soil in Ait Tamlil, Morocco, 31.56, – 6.99).

Etymology.

> Bryum (Greek and Latin) refers to its common habitat amongst mosses, and mundanum (Latin) refers to cosmopolitan distribution.

Notes.

Found in soil in urban (3 out of 4 records) and natural environments in Europe, the Arab Peninsula, and Australia. The soil habitat is supported by three additional GlobalFungi records from natural habitats in Spain, Morocco, and Mexico.

Figures

Figure 38. Diagnostic nucleotide sequences of Bryolpidium mundanum relative to the closest related species in ITS 2 and LSU. Numbers indicate positions in the legitype (marked with an asterisk). Abbreviations for GlobalFungi accessions: d 4847020 b 2, d 4847020 b 222 e 5 b 7830540 d 220 e 20499; 32232805 ae, 32232805 aef 1 d 4510876 e 11 cba 753 f 7 d; and 156 ae 55 aaf, 156 ae 55 aafdd 258247 d 24 e 567 a 23 cdf 3.