Chlosyne definita dolosa, Zhang & Cong & Shen & Song & Grishin, 2023

Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina & Grishin, Nick V., 2023, Genomic analysis reveals new species and subspecies of butterflies, The Taxonomic Report of the International Lepidoptera Survey 11 (6), pp. 1-63 : 11-12

Chlosyne definita dolosa Grishin, new subspecies

http://zoobank.org/ 0CE8273D-D38A-47D7-A73E-A15A3354B0CC

( Figs. 6 part, 8)

Definition and diagnosis. Before this work, western populations of Chlosyne definita (E. Aaron, 1885) ( type locality in USA: Texas, Nueces Co.), including those in northwestern Mexican states of Sonora and Chihuahua have been placed within the subspecies Chlosyne definita anastasia (Hemming, 1934) ( type locality Mexico: Durango, Durango City) due to their phenotypic similarity in having less extensive dark markings and narrower white band and spots on wings venter. Genomic trees reveal that C. d. anastasia is not monophyletic, and the populations near its type locality are genetically differentiated at the species level (i.e., C. anastasia stat. rest., see above) ( Fig. 6), but more northern populations differ from them by 3.3% (22 bp) in COI barcode and are closer related to the nominotypical C. definita (COI barcode difference of 0.6% 4 bp). Therefore, we regard these northwestern Mexico populations as conspecific with C. definita , but due to their phenotypic and genetic differences propose that they constitute a distinct subspecies. This new subspecies is phenotypically more similar to C. anastasia stat. rest. and differs from it in the following characters: the central white band on the ventral hindwing is less broad but broader than in the nominotypical subspecies; black markings are more extensive but less expressed than in the nominotypical subspecies, e.g., the basal white band on the ventral hindwing is typically cut through (or even cut short) by black overscaling around vein 1A+2A. Due to phenotypic variability, definitive identification is provided by DNA, and a combination of the following characters is diagnostic in the nuclear genome: hm2010867-RA.6:C66T, hm2010867-RA.6:G87A, hm2003966-RA.6:T1521C, hm200 3966-RA.6:C4239T, hm2014195-RA.2:A709G and in COI barcode: A40G, 169T, A205T, T283C, T475T.

Barcode sequence of the holotype. Sample NVG-22088C12, GenBank OR837725, 658 base pairs: TACTTTATATTTTATTTTTGGAATTTGAGCAGGTATAGTGGGAACATCTTTAAGACTTTTAATTCGAACAGAATTAGGAAATCCAGGTTCATTAATTGGAGATGATCAAATTTATAATACA ATTGTAACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGTAATTGATTAGTTCCTTTAATATTAGGAGCTCCTGATATAGCTTTCCCACGAA TAAATAATATAAGATTTTGATTATTACCCCCCTCATTAATCCTATTAATTTCCAGAAGAATTGTAGAAAATGGAGCAGGAACAGGATGAACAGTGTACCCCCCACTTTCATCTAATATTGC TCATAGAGGATCATCTGTTGATTTAGCAATTTTTTCATTACATTTAGCTGGAATTTCATCAATTTTAGGAGCAATTAATTTTATCACCACAATCATTAATATACGAGTTAATAATATATCA TTTGATCAAATACCTTTATTTGTTTGAGCAGTAGGTATTACAGCTCTTTTACTACTTTTATCTTTACCTGTATTAGCTGGAGCAATTACAATACTTCTAACTGATCGAAATATTAATACAT CATTCTTTGATCCTGCAGGAGGAGGAGATCCAATTTTATATCAACATTTATTT

Type material. Holotype: ♂ deposited in the McGuire Center for Lepidoptera and Biodiversity, Florida Museum of Natural History, Gainesville, FL, USA [ MGCL], illustrated in Fig. 8, bears four printed (text in italics handwritten) labels: three white [ Chihuahua, Mex. | 19.4 miles E. of | Tomochic Oak-Pine | July 29, 1984. | ca 7000' Leg D. Mullins], [J. D. Turner ex | Malcolm Douglas | colln. | MGCL Accession | # 2009-26], [DNA sample ID: | NVG-22088C12 | c/o Nick V. Grishin ], and one red [ HOLOTYPE ♂ | Chlosyne definita | dolosa Grishin ]. Paratypes: 2♀♀ Mexico, Sonora, 5 mi NW of Yecora, plateau edge, 25-Jul-1987, M. Smith leg. (NVG-22088D10) and 28/ 29-Jul-1987 (NVG-22088D01) [ MGCL].

Type locality. Mexico: Chihuahua, 19.4 mi E of Tomochic , elevation ca. 7000 '.

Etymology. In Latin, dolosus means cunning, deceitful, crafty, or sly. The name is given for the deceitful nature of this subspecies, which was hidden behind the name Chlosyne anastasia before it was revealed by genomic sequence comparison. The name is a feminine adjective.

Distribution. Northwestern Mexico, recorded from the states of Sonora and Chihuahua.