Pseudocopaeodes eunus ash, Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina & Grishin, Nick V., 2023

Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina & Grishin, Nick V., 2023, Genomic analysis reveals new species and subspecies of butterflies, The Taxonomic Report of the International Lepidoptera Survey 11 (6), pp. 1-63 : 42-44

Pseudocopaeodes eunus ash Grishin, new subspecies

http://zoobank.org/ 9EB3AEE9-E29D-4684-9A7D-1EB65A9C6FB5 ( Figs. 44 part, 45a)

Definition and diagnosis. Genomic sequencing of Pseudocopaeodes eunus (W. H. Edwards, 1881) ( type locality USA: Kern Co., the bottoms of Kern River, near Bakersfield) populations reveals that specimens from the Ash Meadows area in southern Nevada are not monophyletic with Pseudocopaeodes eunus alinea J. Scott, 1981 ( type locality in USA: California, San Bernardino Co., Afton Canyon) despite the similarity in being less marked than other populations, and form a distinct clade with genetic differentiation larger than for some other P. eunus subspecies ( Fig. 44), e.g., their COI barcodes differ by 1.1% (7 bp). Therefore, the Ash Meadows population represents a new subspecies. This subspecies is most similar to P. e. alinea in appearance and differs from it in having less conspicuous and thinner

In particular, palpi beneath, cheeks, area by ventral forewing costa at the wing base, forewing apex, and hindwing overall are whiter (and wing venter redder) than in P. e. alinea, which is yellower ( Fig. 45b). Dorsal hindwing by the apex is usually less dark, and dark scales by the costa are confined mostly to the base. Definitive identification is provided by DNA, and a combination of the following characters is diagnostic in the nuclear genome: aly 1022.2.1:G558A, aly 1781.2.2:C384 T , aly 1781.2.2:G444A, aly4645.18. 2:C183 T , aly4645.18.2: T213 A and in COI barcode can be distinguished from other subspecies, except Pseudocopaeodes eunus obscurus Austin & J. Emmel, 1998 ( type locality in USA: Nevada, Carson City ): A214A, T220 C, A484A, T514 T , 604C.

Barcode sequence of the holotype. Sample NVG-21049E06, GenBank OR837738, 658 base pairs: AACTTTATATTTTATTTTTGGTATCTGAGCAGGAATATTAGGAACTTCTTTAAGTTTATTAATTCGAACAGAATTAGGTAATCCTGGATCTTTAATTGGAGATGATCAAATTTATAATAGT ATTGTTACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCAATTATAATTGGAGGATTTGGAAATTGATTAGTTCCATTAATATTAGGAGCCCCAGATATAGCTTTCCCACGAA TAAATAATATAAGATTTTGAATATTACCCCCATCATTAATATTATTAATCTCAAGAAGAATTGTAGAAAATGGAGCAGGAACAGGTTGAACTGTTTATCCTCCTTTATCTTCTAATATTGC TCATCAAGGATCTTCTGTTGATTTAGCAATTTTTTCTCTTCATTTAGCTGGTATTTCATCTATTTTAGGAGCTATTAATTTTATTACAACAATTATTAATATACGAATTAAAAATTTATCA TTTGACCAAATACCTTTATTTGTATGATCTGTAGGAATTACAGCTTTATTATTATTATTATCTTTACCTGTATTAGCTGGAGCTATTACTATATTACTTACTGATCGAAATTTAAATACCT CTTTTTTTGATCCTGCAGGAGGAGGAGATCCAATTTTATATCAACATTTATTT

Type material. Holotype: ♂ deposited in the McGuire Center for Lepidoptera and Biodiversity, Florida Museum of Natural History, Gainesville, FL, USA [ MGCL], illustrated in Fig. 45a, bears four labels, 1 st handprinted others printed: three white [ ASH MEADOWS | NYE CO. NEV. | 2 SEPT. 1989 | LEG:P. SAVAGE], [P Savage colln. | MGCL Acc. | 2006-15], [DNA sample ID: | NVG-21049E06 | c/o Nick V. Grishin ], and one red [ HOLOTYPE ♂ | Pseudocopaeodes | eunus ash Grishin ]. Paratypes: 2♂♂ 2♀♀ same locality as the holotype: 2♂♂ 6-Sep-1987, P. Savage colln. (NVG-22076F04 and NVG-22076F05) [ MGCL], 1♀ 7-Sep-1988, P. Savage leg. (NVG-21049E07) [ MGCL], and 1♀ 12-Aug-1984 G. T. Austin leg. (NVG-20063G12, CSU _ ENT 1028906) [ CSUC].

Etymology. The name is given for the type locality and the ashier appearance: paler, whiter, ventrally dusted with white compared to other subspecies. The name is treated as a masculine noun in apposition.

Distribution. Southern Nevada; known only from the Ash Meadows area.

Comments. First, we note that where P. eunus is double-brooded, the two broods differ in appearance. The first one produces darker specimens with broader dark-framed veins and more conspicuous two pale rays of the ventral hindwing, thus having a classical P. eunus appearance. The second brood produces paler specimens. Therefore, wing patterns within the broods should be compared between populations to reach meaningful conclusions. Second, we see that genetic differentiation between the two subspecies Pseudocopaeodes eunus obscurus Austin & J. Emmel, 1998 (type locality in USA: Nevada, Carson City) and Pseudocopaeodes eunus flavus Austin & J. Emmel, 1998 (type locality in USA: Nevada, Churchill Co.) is limited compared to others ( Fig. 44), suggesting that they are not particularly distinct from each other, despite their phenotypic difference in wing patterns. Thus, wing patterns can differ with very few genetic changes. Third, we observe the genetic similarity between the lectotype of Copaeodes wrightii W. H. Edwards, 1882 (type locality USA: California, San Bernardino Co., nr. Victorville) currently treated as a junior subjective synonym of the nominal P. eunus and the type series of Pseudocopaeodes eunus alinea J. Scott, 1981 (type locality USA: California, San Bernardino Co., Afton Canyon) ( Fig. 44). While additional analyses are required, it may be that C. wrightii is not a synonym of P. e. eunus , but instead is a valid subspecies and the same taxon as P. e. alinea, with the latter being its junior subjective synonym.