Aquieurochytrium Tedersoo & Esmaeilzadeh-Salestani, 2025

Tedersoo, Leho, Hosseyni Moghadam, Mahdieh S., Panksep, Kristel, Prins, Victoria, Anslan, Sten, Mikryukov, Vladimir, Bahram, Mohammad, Abarenkov, Kessy, Kõljalg, Urmas, Esmaeilzadeh-Salestani, Keyvan, Pawłowska, Julia, Wurzbacher, Christian, Ding, Yi, Alkahtani, Saad Hussin & Nilsson, R. Henrik, 2025, Thirty novel fungal lineages: formal description based on environmental samples and DNA, MycoKeys 124, pp. 1-121 : 1-121

Aquieurochytrium Tedersoo & Esmaeilzadeh-Salestani gen. nov.

Type species.

Aquieurochytrium lacustre Tedersoo & Esmaeilzadeh-Salestani .

Diagnosis.

Distinguishable from other fungi based on diagnostic nucleotide signatures in ITS 2 (positions 160–168 ccgcgacga; one mismatch allowed) and LSU D 2 (positions 618–637 in type species and 591–610 in S. cerevisiae tcgcagcgcaccgtaaggcg). Forms a monophyletic, least inclusive clade in Aquieurochytriaceae, covering sequences EUK 1102113 and EUK 1102276 (Figs 1 , 6 ).

Notes.

Recognized based on eDNA sequences only. Comprises potentially 25–30 species represented by sequences EUK 1102276 (lake water in Sweden), EUK 0569233 (lake water in Estonia), and EUK 0569237 (lake water in Benin).

Figures

Figure 1. Maximum Likelihood SSU- 5.8 S-LSU phylogram indicating placement of novel lineages in the fungal kingdom as highlighted in a coloured shade and red font. Previously described taxonomic clades are collapsed. All branches of Sumavosporidiomycetes and Gelotisporidiomycetes are shortened two-fold. Poorly supported branches with bootstrap values below 95 % / 99 % are indicated in blue. The original tree with bootstrap values and uncollapsed branches is indicated in Suppl. material 1.

Figure 6. Maximum Likelihood SSU- ITS - LSU phylogram indicating the position of Aquieurochytrium lacustre within Aquieurochytriomycetes, with ultra-rapid bootstrap values indicated (for higher-level classifications mainly). Other genus-level groups are collapsed. Chytridiomycota spp. were used as an outgroup.