Clavicornaltica belalongensis Schilthuizen et al., 2019

Schilthuizen, Menno, Berenyi, Alfie E. A., Limin, Army, Brahim, Aqilah, Cicuzza, Daniele, Eales, Anthony J., Escoubas, Pierre, Grafe, Ulmar, de Groot, Michiel D., Hayden, William C., Paterno, Marta, Jambul, Rafi'ah, Slik, J. W. Ferry, Ting Teck Wah, Dennis, Tucker, Angela & Njunjic, Iva, 2019, A new species of Clavicornaltica (Coleoptera: Chrysomelidae), discovered and described on a field course to Kuala Belalong, Brunei, Biodiversity Data Journal 7, pp. 32555-32555 : 32555

Clavicornaltica belalongensis Schilthuizen et al., 2019 sp. n.

Materials

Type status: Holotype. Occurrence: recordedBy: Taxon Expeditions field course participants; individualCount: 1; sex: female; lifeStage: adult; preparations: card-mounted; disposition: in collection; Taxon: scientificName: Clavicornalticabelalongensis; kingdom: Animalia; phylum: Arthropoda; class: Hexapoda; order: Coleoptera; family: Chrysomelidae; taxonRank: species; scientificNameAuthorship: Schilthuizen et al., 2019; nomenclaturalCode: ICZN; Location: locationID: TxExBr0004w; continent: Asia; island: Borneo; country: Brunei Darussalam; stateProvince: Temburong; locality: Kuala Belalong Field Studies Centre ; verbatimLocality: Ulu Temburong, near Kuala Belalong Field Studies Centre, along Ashton Trail; verbatimElevation: 120; decimalLatitude: 4.5472; decimalLongitude: 115.1571; Identification: identificationID: UBDM.3.01171; Event: samplingProtocol: Winkler sampling; samplingEffort: 150 l of forest leaf litter; eventDate: 2018-09-27; habitat: Lowland dipterocarp forest; Record Level: type: PhysicalObject; bibliographicCitation: Clavicornalticabelalongensis (UBDM.3.01171); institutionID: UBD; institutionCode: IBER-UBD; collectionCode: Zoology; basisOfRecord: PreservedSpecimen Type status: Paratype. Occurrence: recordedBy: Taxon Expeditions field course participants; individualID: TxExBr0004w-2; individualCount: 1; sex: female; lifeStage: adult; preparations: card-mounted; disposition: in collection; Taxon: scientificName: Clavicornalticabelalongensis; kingdom: Animalia; phylum: Arthropoda; class: Hexapoda; order: Coleoptera; family: Chrysomelidae; genus: Clavicornaltica; specificEpithet: belalongensis; taxonRank: species; scientificNameAuthorship: Schilthuizen et al., 2019; nomenclaturalCode: ICZN; Location: locationID: TxExBr0004w; continent: Asia; island: Borneo; country: Brunei Darussalam; stateProvince: Temburong; locality: Kuala Belalong Field Studies Centre ; verbatimLocality: Kuala Belalong Field Studies Centre, along Ashton trail; verbatimElevation: 120 m; verbatimLatitude: 4.5472; verbatimLongitude: 115.1571; Event: samplingProtocol: Winkler sampling; samplingEffort: 150 l of forest leaf litter; eventDate: 2018-09-27; habitat: Lowland dipterocarp forest; Record Level: type: PhysicalObject; bibliographicCitation: Clavicornalticabelalongensis (UBDM.3.01172); institutionID: UBD; institutionCode: IBER-UBD; collectionCode: Zoology; basisOfRecord: PreservedSpecimen Type status: Paratype. Occurrence: recordedBy: Taxon Expeditions field course participants; individualID: TxExBr0014w-3; individualCount: 1; sex: female; lifeStage: adult; preparations: card-mounted; disposition: in collection; Taxon: scientificName: Clavicornalticabelalongensis; kingdom: Animalia; phylum: Arthropoda; class: Hexapoda; order: Coleoptera; family: Chrysomelidae; genus: Clavicornaltica; specificEpithet: belalongensis; taxonRank: species; scientificNameAuthorship: Schilthuizen et al., 2019; nomenclaturalCode: ICZN; Location: locationID: TxExBr0014w-3; continent: Asia; island: Borneo; country: Brunei Darussalam; stateProvince: Temburong; locality: Kuala Belalong Field Studies Centre ; verbatimLocality: Kuala Belalong Field Studies Centre, along Ashton trail; verbatimElevation: 120 m; decimalLatitude: 4.5472; decimalLongitude: 115.1571; Event: samplingProtocol: Winkler sampling; samplingEffort: 150 l of forest leaf litter; eventDate: 2018-09-27; habitat: Lowland dipterocarp forest; Record Level: type: PhysicalObject; bibliographicCitation: Clavicornalticabelalongensis (UBDM.3.01173); institutionID: UBD; institutionCode: IBER-UBD; collectionCode: Zoology; basisOfRecord: PreservedSpecimen Type status: Paratype. Occurrence: recordedBy: Taxon Expeditions field course participants; individualID: TxExBr0004w-4; individualCount: 1; sex: female; lifeStage: adult; preparations: card-mounted; disposition: in collection; Taxon: scientificName: Clavicornalticabelalongensis; kingdom: Animalia; phylum: Arthropoda; class: Hexapoda; order: Coleoptera; family: Chrysomelidae; genus: Clavicornaltica; specificEpithet: belalongensis; taxonRank: species; scientificNameAuthorship: Schilthuizen et al., 2019; nomenclaturalCode: ICZN; Location: locationID: TxExBr0004w; continent: Asia; island: Borneo; country: Brunei Darussalam; stateProvince: Temburong; locality: Kuala Belalong Field Studies Centre ; verbatimLocality: Kuala Belalong Field Studies Centre, along Ashton trail; verbatimElevation: 120 m; decimalLatitude: 4.5472; decimalLongitude: 115.1571; Event: samplingProtocol: Winkler sampling; samplingEffort: 150 l of forest leaf litter; eventDate: 2018-09-27; habitat: Lowland dipterocarp forest; Record Level: type: PhysicalObject; bibliographicCitation: Clavicornalticabelalongensis (UBDM.3.01174); institutionID: UBD; institutionCode: IBER-UBD; collectionCode: Zoology; basisOfRecord: PreservedSpecimen Type status: Paratype. Occurrence: recordedBy: Taxon Expeditions field course participants; individualID: TxExBr0004w-5; individualCount: 1; sex: female; lifeStage: adult; preparations: card-mounted; disposition: in collection; Taxon: scientificName: Clavicornalticabelalongensis; kingdom: Animalia; phylum: Arthropoda; class: Hexapoda; order: Coleoptera; family: Chrysomelidae; genus: Clavicornaltica; specificEpithet: belalongensis; taxonRank: species; scientificNameAuthorship: Schilthuizen et al., 2019; nomenclaturalCode: ICZN; Location: locationID: TxExBr0004w; continent: Asia; island: Borneo; country: Brunei Darussalam; stateProvince: Temburong; locality: Kuala Belalong Field Studies Centre ; verbatimLocality: Kuala Belalong Field Studies Centre, along Ashton trail; verbatimElevation: 120 m; decimalLatitude: 4.5472; decimalLongitude: 115.157; Event: samplingProtocol: Winkler sampling; samplingEffort: 150 l of forest leaf litter; eventDate: 2018-09-27; habitat: Lowland dipterocarp forest; Record Level: type: PhysicalObject; bibliographicCitation: Clavicornalticabelalongensis (UBDM.3.01176); institutionID: UBD; institutionCode: IBER-UBD; collectionCode: Zoology; basisOfRecord: PreservedSpecimen Type status: Paratype. Occurrence: recordedBy: Taxon Expeditions field course participants; individualID: TxExBr0004w-8; individualCount: 1; sex: female; lifeStage: adult; preparations: card-mounted; disposition: in collection; Taxon: scientificName: Clavicornalticabelalongensis; kingdom: Animalia; phylum: Arthropoda; class: Hexapoda; order: Coleoptera; family: Chrysomelidae; genus: Clavicornaltica; specificEpithet: belalongensis; taxonRank: species; scientificNameAuthorship: Schilthuizen et al., 2019; nomenclaturalCode: ICZN; Location: locationID: TxExBr0004w; continent: Asia; island: Borneo; country: Brunei Darussalam; stateProvince: Temburong; locality: Kuala Belalong Field Studies Centre ; verbatimLocality: Kuala Belalong Field Studies Centre, along Ashton trail; verbatimElevation: 120 m; decimalLatitude: 4.5472; decimalLongitude: 115.1571; Event: samplingProtocol: Winkler sampling; samplingEffort: 150 l of forest leaf litter; eventDate: 2018-10-01; habitat: Lowland dipterocarp forest; Record Level: type: PhysicalObject; bibliographicCitation: Clavicornalticabelalongensis (UBDM.3.01175); institutionID: UBD; institutionCode: IBER-UBD; collectionCode: Zoology; basisOfRecord: PreservedSpecimen

Description

Body orange-red, small, nearly hemispherical, 1.15-1.30 mm long and 0.9-1.1 mm wide (i.e. ca. 1.25 times as long as wide) (Fig. 2). Elytra with punctate rows, deeply impressed along their entire length. Spermathecal receptacle pear-shaped and distinctly separated from the pump. Female wingless. Male unknown.

Head (Fig. 3): Rectangular, ca. 0.35 mm wide (measured across the eyes), densely beset with confluent double punctuation; tubercles and midfrontal sulcus poorly developed and inconspicuous. Eyes convex, each eye consisting of 26-30 ommatidia, ca. 1/5 the width of the head measured across the eyes in dorsal view. Antennae: clava long and moderately robust.

Pronotum: Very weakly shagreened and punctuated; punctures sparse and minute, of similar strength to the subordinate punctuation on the elytra; pronotal surface therefore shiny. Lateral margin with a callosity that stretches from the anterior to the posterior corner. Lateral setiferous pore at 2/3 of the length of the margin, seta as long as the clava of the antenna, pore removed from the margin by a distance similar to the width of antennomere II. Posterior setiferous pore placed directly at the margin, the seta length similar to antennomeres IX+X.

Hind wings: Absent.

Elytra: Shiny, punctate in 9 longitudinal rows, scutellar row ¼ the length of the other rows, consisting of ca. 6 punctures. Punctures in all rows deeply impressed along their entire length (puncture width is similar to their interspaces). In between, the major punctures are irregularly scattered and there are much smaller subordinate punctures. A rudiment of a 10th row exists in the final 1/3 flanking the elytral margin. A fine groove runs along the entire margin continuing to the apex; apex itself slightly drawn out. The internal edge of epipleura carries a short row of punctures, alongside the 4th and 5th visible sternite.

Legs: Tibia and tarsus orange, femur dark orange and robust. Metafemur robust, oval, covered in reticulate microsculpture. External edge of metatibia bearing two parallel rows of 8-10 minute stiff setae placed along the terminal one-fifth and flanking the basis of metatarsomere I. Internal side of metatibia bearing ca. 10 thin setae that are placed along the terminal half of the tibia and increase to about 2.5 × the length of the external setae, then decrease in length towards the apex. The metatibia carries a long terminal spine of about the same length as metatarsomere I. No serrations or microteeth are visible on the spine.

Mesosternum: Processus rounded, with a distinct margin, central area somewhat convex.

Abdomen: Carina on the first visible abdominal sternite sharp and narrow, not broadened anteriorly or posteriorly, running along the length of the sternite. In reduced form, this carina is carried on to the four posterior sternites, which therefore, in lateral view, offer a slightly serrated aspect. The surface of the sternites carries a rough microsculpture of confluent punctures. Tergum IX (last visible tergite) with three longitudinal median ridges, the central one of which is much weaker than the two outermost. Subapically, tergum IX has a horizontal row of 8 serrations.

Female genitalia: Spermatheca consisting of a pear-shaped receptacle, ca. 90 µm in length, with crosswise annulations (Fig. 4a.) The strongly bent pump is 1/3 the width of the receptacle, attached to the widest part of the receptacle and distinctly separated from it. Duct as long as the pump. Tignum long (0.5 mm) and narrow (10 µm). Vaginal palpi fused basally, long (300 µm) and narrow (max. 10 µm), terminally provided with two long, externally pointing setae (Fig. 4b).

DNA barcode: 5'GACTTTCCCTTAGTATATTAATCCGAATCGAATTAAGAAATCCAAGATCATTTATTTCTAATATTCATTTATATAATGTTTTAGTAACAATACATGCTTTTATTATAATTTTTTTTATAATTATACCAATTATAATTGGAGGATTCGGAAATTGATTAATCCCACTAATAATTGGGGCCCCTGATATAGCCTTCCCACGTATAAATAACCTAAGATTCTGATTTTTACCTCCTTCTATAATCTTATTAATTCTTAGTATATTTAGTGAAATAGGAGCAGGAAGAGGATGAACCCTTTATCCCCCATTATCAAATACTTTCTTCCATAATGGACCCGCTATTGACCTAACTATTTTTAGTCTTCATTTAGCTGGAATCTCATCAATCCTTGGAGCAATAAACTTTATTTCTACAATAATTAATATAAAAATTTATAAATTAAAATTTGATCAAATAACCCTCTTTTCTTGAGCTTCCCTTATTACAACTATTCTATTACTATTAGCTTTACCTGTATTAGCAGGAGCTATCACTATACTACTTACAGATCGTAATCTTAATACTTCTTTTTTTGATCCCTCAGGAGGAGGAGACCCCCTATTATAT3' (holotype, UBDM.3.01171; BOLD accession TXEX004-18)

Diagnosis

The most important diagnostic features in which Clavicornaltica belalongensis sp. n. differs from all other known Clavicornaltica are (i) the pear-shaped spermathecal receptacle that is distinctly separated from the pump and (ii) the medially keeled abdominal sternites. Furthermore, the new species can be separated from other oriental Clavicornaltica in the following respects: C. fortepunctata Scherer, 1974 (Vietnam) is more elongate ( Medvedev 1996); Clavicornaltica malayana Medvedev, 1996 (West-Malaysia) is black, the pronotum is impunctate and it is also much larger (1.9 mm) ( Medvedev 1996); Clavicornaltica pusilla Scherer, 1974 and C. loebli Scherer, 1974 (Sri Lanka) have impunctate elytra ( Medvedev 1996); Clavicornaltica besucheti Scherer, 1974 (Sri Lanka) is larger (>1.5 mm) ( Medvedev 1996); Clavicornaltica iriana sarawacensis Medvedev, 1996 (Borneo) is reddish-black and the elytral punctuation is reduced ( Medvedev 1996); Clavicornaltica tarsalis Medvedev, 1996 (New Guinea) has a widened first protarsomere and an anteriorly widened carina on the 1st abdominal segment ( Medvedev 1996); Clavicornaltica philippinensis Scherer, 1979 (Philippines) has a wide plate on the underside of the 1st abdominal sternite; Clavicornaltica trautneri Medvedev, 1993 is much larger (2.1 mm) ( Medvedev 1996); Clavicornaltica schereri Basu & Sen Gupta, 1981 (India) has a posteriorly narrowed pronotum ( Basu and Gupta 1981); Clavicornaltica rileyi Döberl, 2002 (India) has an anteriorly widened carina on the 1st abdominal segment ( Döberl 2003); Clavicornaltica takizawai Döberl, 2009 (Nepal) has the spermathecal pump fused with the receptacle and a widened carina on the first abdominal segment ( Döberl 2009); Clavicornaltica tamdao Konstantinov & Duckett, 2005 (Vietnam) has the spermathecal pump fused with the receptacle ( Konstantinov and Duckett 2005); Clavicornaltica dali Konstantinov & Duckett, 2005 (Yunnan) has the mesosternal processus flat, not convex ( Konstantinov and Duckett 2005); Clavicornaltica vietnamensis Konstantinov & Duckett, 2005 (Vietnam) has the spermathecal pump wider than the receptacle ( Konstantinov and Duckett 2005); Clavicornaltica longsheng Konstantinov & Duckett, 2005 (Guangxi) has vaginal palpi very short and the spermathecal pump wider than the receptacle ( Konstantinov and Duckett 2005); Clavicornaltica buechei Medvedev, 2008 (Sulawesi) is 1.6 times as long as wide and has the carina on the 1st abdominal sternite widened posteriorly ( Medvedev 2008); Clavicornaltica mussardi Scherer, 1974 (Sri Lanka) is larger and more elongate; its head is not shagreened ( Scherer 1974); Clavicornaltica mizusawai Suenaga & Yoshida, 2016 (Taiwan) has a spherical spermathecal receptacle, the carina on the 1st abdominal sternite is widened anteriorly and is flanked by rows of strong punctures, the metafemur is more elongated and the vaginal palpi are diverging, not parallel ( Suenaga and Yoshida 2016); Clavicornaltica sakishimana Suenaga & Yoshida, 2016 (Japan) has a much more elongate habitus ( Suenaga and Yoshida 2016); finally, Clavicornaltica takimotoi Lesage, 1997 (Taiwan) has impunctate elytra and a black body ( Suenaga and Yoshida 2016).

Etymology

The species is named after the Belalong river; the new species was recorded in the close vicinity of the river’s left bank. Following Article 51C of the Code ( ICZN 1999), the species can be referred to as Clavicornaltica belalongensis Schilthuizen et al., 2019, provided the full citation of this publication appears in the bibliography or elsewhere in the referring work.

Distribution

Known only from a location near the confluence of the Belalong and Temburong rivers, at 120 m elevation (Kuala Belalong Field Studies Centre; Fig. 1). Five of the six specimens were collected from between buttress roots, whereas only one was from the open forest floor.

Taxon discussion

All six specimens we obtained were females. The spermatheca in Clavicornaltica is generally diagnostic, perhaps even more so than the aedeagus. This, combined with the fact that we obtained a DNA barcode for the holotype, provides sufficient basis for the description of a new species. We expect that a future taxon expedition to the same location will eventually allow the description of the male as well.